Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00027645
Proper Citation: RRID:WB-STRAIN:WBStrain00027645
Description: Caenorhabditis elegans with name ifta-1(nx61) X. from WB.
Species: Caenorhabditis elegans
Synonyms: ifta-1(nx61) X.
Notes: Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
Affected Gene: WBGene00016935(ifta-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for MX124.
No alerts have been found for MX124.
Source: Integrated Animals
Source Database: WormBase (WB)
