Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00050711
Proper Citation: RRID:WB-STRAIN:WBStrain00050711
Description: Caenorhabditis elegans with name nlp-8(syb762) IV. from WB.
Species: Caenorhabditis elegans
Synonyms: nlp-8(syb762) IV.
Notes: Made_by: Marina Sinner /SunyBiotech|"syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791"
Affected Gene: WBGene00003746(nlp-8)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for nlp-8(syb762) IV..
No alerts have been found for nlp-8(syb762) IV..
Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org
Source Database: WormBase (WB)
