Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 10 showing 181 ~ 200 out of 566 results
Snippet view Table view Download 566 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_206026

http://www.addgene.org/206026

Species: Mus musculus
Genetic Insert: ORF2 derived from mouse LINE1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pZeoSV2(+); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33938150

Proper citation: RRID:Addgene_206026 Copy   


  • RRID:Addgene_210788

http://www.addgene.org/210788

Species: Synthetic
Genetic Insert: Defective hygromycin resistant gene
Vector Backbone Description: Backbone Marker:Dirk Schnappinger; Backbone Size:3592; Vector Backbone:pDE43-MCZ; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34235660
Comments: Defective hygromycin-resistant gene was generated by overlap PCR and cloned into the PvuI-HindIII sites of pDE43-MCZ, a mycobacterial phage L5 integrating vector.

Proper citation: RRID:Addgene_210788 Copy   


  • RRID:Addgene_71265

http://www.addgene.org/71265

Species: Other
Genetic Insert: VenusYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26644504

Proper citation: RRID:Addgene_71265 Copy   


  • RRID:Addgene_55190

http://www.addgene.org/55190

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55190 Copy   


  • RRID:Addgene_91729

http://www.addgene.org/91729

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91729 Copy   


http://www.addgene.org/91747

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91747 Copy   


http://www.addgene.org/91748

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91748 Copy   


http://www.addgene.org/91745

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91745 Copy   


http://www.addgene.org/91746

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91746 Copy   


http://www.addgene.org/91744

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91744 Copy   


http://www.addgene.org/91740

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91740 Copy   


http://www.addgene.org/91738

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91738 Copy   


http://www.addgene.org/91734

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91734 Copy   


http://www.addgene.org/91735

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91735 Copy   


http://www.addgene.org/91732

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91732 Copy   


http://www.addgene.org/91730

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91730 Copy   


http://www.addgene.org/91754

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91754 Copy   


http://www.addgene.org/91752

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91752 Copy   


http://www.addgene.org/91750

Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348

Proper citation: RRID:Addgene_91750 Copy   


  • RRID:Addgene_92053

http://www.addgene.org/92053

Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pMAZ-SK; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:28764701

Proper citation: RRID:Addgene_92053 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X