Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: M13_central_T_linker_rrnD_T1 double terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 100% (97% and 99% alone, respectively).
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47858 Copy
Species: Synthetic
Genetic Insert: ilvGEDA
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47851 Copy
Species: Synthetic
Genetic Insert: BBa_B1006 U10
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47857 Copy
Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Comments: Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572
Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8.
Proper citation: RRID:Addgene_47975 Copy
Species: Synthetic
Genetic Insert: tetAC terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 50%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47855 Copy
Species: Synthetic
Genetic Insert: lambda tR2 terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 91%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47849 Copy
Species: Synthetic
Genetic Insert: T7 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 96%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47847 Copy
Species: Synthetic
Genetic Insert: T3 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 94%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47848 Copy
Species: Synthetic
Genetic Insert: promoter 13 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98
Proper citation: RRID:Addgene_47844 Copy
Species: Synthetic
Genetic Insert: monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043132
Proper citation: RRID:Addgene_53234 Copy
Species: Synthetic
Genetic Insert: YFP
Vector Backbone Description: Backbone Marker:Lutz and Bujard 1997; Backbone Size:4000; Vector Backbone:pzs*11; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23277573
Proper citation: RRID:Addgene_53241 Copy
Species: Synthetic
Genetic Insert: alpha3D
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10318910
Proper citation: RRID:Addgene_53310 Copy
Species: Synthetic
Genetic Insert: SKL amino acids
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21132080
Proper citation: RRID:Addgene_53450 Copy
Species: Synthetic
Genetic Insert: Clover GFP
Vector Backbone Description: Backbone Marker:Broad Institute; Vector Backbone:pMPRA2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895
Proper citation: RRID:Addgene_53539 Copy
Species: Synthetic
Genetic Insert: Clover GFP
Vector Backbone Description: Backbone Marker:Broad Institute; Vector Backbone:pMPRA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895
Comments: Addgene sequencing detected an IS1 transposable element
Proper citation: RRID:Addgene_53540 Copy
Species: Synthetic
Genetic Insert: Nano-lantern-based luminescent cAMP indicator
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Proper citation: RRID:Addgene_53591 Copy
Species: Synthetic
Genetic Insert: Nano-lantern-based luminescent cAMP indicator
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Proper citation: RRID:Addgene_53594 Copy
Species: Synthetic
Genetic Insert: Nano-lantern-based luminescent cAMP indicator
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Proper citation: RRID:Addgene_53595 Copy
Species: Synthetic
Genetic Insert: Nano-lantern-based luminescent cAMP indicator
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Proper citation: RRID:Addgene_53592 Copy
Species: Synthetic
Genetic Insert: C-D dummy
Vector Backbone Description: Backbone Marker:Parniske lab; Vector Backbone:pUC57 (Gent); Vector Types:cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:24551083
Comments: L1 dummy.
Proper citation: RRID:Addgene_54343 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.