Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::cfp intergrated at intS
Proper citation: RRID:Addgene_61160 Copy
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at arpB + ∆lacI
Proper citation: RRID:Addgene_61164 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22982858
Comments: We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics).
See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2.
Proper citation: RRID:Addgene_52055 Copy
Genetic Insert: Oplac2 (37)-KI strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KIlac with those of OpLac2.
Proper citation: RRID:Addgene_52702 Copy
Genetic Insert: ΔYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacY and lacA deletion
Proper citation: RRID:Addgene_52708 Copy
Genetic Insert: ΔZA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacZ and lacA deletion
Proper citation: RRID:Addgene_52707 Copy
Genetic Insert: W999L strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Proper citation: RRID:Addgene_52713 Copy
Genetic Insert: E537Q strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Proper citation: RRID:Addgene_52714 Copy
Genetic Insert: G794A strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Proper citation: RRID:Addgene_52711 Copy
Genetic Insert: W999F strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Proper citation: RRID:Addgene_52712 Copy
Genetic Insert: ΔZYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: MG1655 was transformed with pKD46 (carrying phage lambda Red recombinase) and a PCR fragment encoding a kanamycin resistance gene with flanking nucleotide sequences homologous to those flanking the lac operon. Upon recombination and selection for resistant strains, the kanamycin-resistant gene was eliminated following transformation with pCP20 (encoding the FLP recombinase), which is subsequently cured by growth at 30°C. The deletion in our ΔZYA strain started 20bp upstream of lacI and ran 40bp downstream of lacA.
Proper citation: RRID:Addgene_52695 Copy
Genetic Insert: OpLac1-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac1Δ6 were erroneously synthesized missing the first 6 nucleotides of Oplac1. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.
Proper citation: RRID:Addgene_52698 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:25087841
Proper citation: RRID:Addgene_52942 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:23878244
Proper citation: RRID:Addgene_52950 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt trpR::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of trpR knock-out:
Fwd - prEP184, gtatcactctctgctttattaccggcaa
Rev - prEP186, gcggcaataatggtgtcgat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229546 Copy
Species: n/a
Genetic Insert: ΔcyaA ΔcpdA ΔlacY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:17376875
Comments: Primers:
oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG
oSK286, cpdA-rev: CACTGCGGGCAGCATAAA
oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG
oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC
oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC
oSK290, CyaA-rev: GCTGCACCAGGTATGGCT
Proper citation: RRID:Addgene_196340 Copy
Species: E. coli
Genetic Insert: DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31]
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:40493021
Proper citation: RRID:Addgene_242527 Copy
Species: n/a
Genetic Insert: none
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40595632
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C
To verify the gyrA gene using the following primers:
gyrA462-F: cccgtcgtactattttcgaac
gyrA462-R: cagcagtcggtcgataaagtc
The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference.
Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above.
Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.
Proper citation: RRID:Addgene_237425 Copy
Species: n/a
Genetic Insert: tnaA-
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:39610115
Comments: Derived from E. coli K-12 MG1655 strain. This strain does not produce indole as measured with Kovac's Reagent Indole Test. A T7 phage strain with a gp1 KO is available from the Whitehead Lab.
Please visit https://doi.org/10.1101/2024.08.07.607023 for bioRxiv preprint.
Proper citation: RRID:Addgene_228513 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
