Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35594503
Comments: Primers for PCR verification:
veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG
veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC
veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG
veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG
Proper citation: RRID:Addgene_205015 Copy
Species: E. coli
Genetic Insert: bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:16979134
Comments: Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983
Proper citation: RRID:Addgene_186997 Copy
Species: E. coli
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31772280
Comments: Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514
KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941.
Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter.
The parent strain KTD101 was provided by François Baneyx at the University of Washington.
DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.
Proper citation: RRID:Addgene_138651 Copy
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35077145
Comments: Genotype: E. coli MG1655ΔCRISPR-Cas
Method: Knockout using pKD46/pKD4
Created by: Baiyang Liu
Knockout region from MG1655 genome: 995605 to 1006007
Primer Fw: GATTATCGACTGGGATAACC
Primer Rv: CAGAAATATTCGACAAAGCG
Expected PCR size for JEC027: 1kb
Expected PCR size for MG1655: 10.4kb
Proper citation: RRID:Addgene_180310 Copy
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.
Proper citation: RRID:Addgene_34928 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230042 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230041 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230040 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230035 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230039 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230036 Copy
Species: n/a
Genetic Insert: tnaA-
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:39610115
Comments: Derived from E. coli K-12 MG1655 strain. This strain does not produce indole as measured with Kovac's Reagent Indole Test. A T7 phage strain with a gp1 KO is available from the Whitehead Lab.
Please visit https://doi.org/10.1101/2024.08.07.607023 for bioRxiv preprint.
Proper citation: RRID:Addgene_228513 Copy
Genetic Insert: MG1655 Z1 malE clpA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26900850
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, clpA-
Proper citation: RRID:Addgene_65918 Copy
Genetic Insert: MG1655 Z1 malE aat
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26900850
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, aat-
Proper citation: RRID:Addgene_65917 Copy
Species: n/a
Genetic Insert: ΔcyaA ΔcpdA ΔlacY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:17376875
Comments: Primers:
oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG
oSK286, cpdA-rev: CACTGCGGGCAGCATAAA
oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG
oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC
oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC
oSK290, CyaA-rev: GCTGCACCAGGTATGGCT
Proper citation: RRID:Addgene_196340 Copy
Species: E. coli
Genetic Insert: DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31]
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:40493021
Proper citation: RRID:Addgene_242527 Copy
Species: Other
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:42199375
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ]
Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT).
Strain validation:
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp.
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp.
- PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
Proper citation: RRID:Addgene_235121 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248174 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248176 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
