Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
E. coli BW25113 ΔtnaA ΔtrpR Resource Report Resource Website |
RRID:Addgene_205015 | ΔtnaA ΔtrpR | E. coli | None | PMID:35594503 | Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:27:20 | 0 | |
|
BA14 Resource Report Resource Website |
RRID:Addgene_186997 | bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N | E. coli | None | PMID:16979134 | Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:23:54 | 0 | |
|
KTD101(DE3) Resource Report Resource Website |
RRID:Addgene_138651 | None | E. coli | None | PMID:31772280 | Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514 KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941. Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter. The parent strain KTD101 was provided by François Baneyx at the University of Washington. DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:23:04 | 0 | |
|
JEC027 Resource Report Resource Website |
RRID:Addgene_180310 | None | PMID:35077145 | Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:22:52 | 0 | |||
|
Top10∆serB Resource Report Resource Website |
RRID:Addgene_34928 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:14:03 | 0 | |||
|
TB205 △ilvA Resource Report Resource Website |
RRID:Addgene_230042 | MG1655 attP21::PR-mCherry::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB204 △ilvA Resource Report Resource Website |
RRID:Addgene_230041 | MG1655 attP21::PR-sfGFP::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB205 △metA Resource Report Resource Website |
RRID:Addgene_230040 | MG1655 attP21::PR-mCherry::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB204 △proC Resource Report Resource Website |
RRID:Addgene_230035 | MG1655 attP21::PR-sfGFP::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB204 △metA Resource Report Resource Website |
RRID:Addgene_230039 | MG1655 attP21::PR-sfGFP::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB205 △proC Resource Report Resource Website |
RRID:Addgene_230036 | MG1655 attP21::PR-mCherry::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
MG1655 tnaA- Resource Report Resource Website |
RRID:Addgene_228513 | tnaA- | n/a | None | PMID:39610115 | Derived from E. coli K-12 MG1655 strain. This strain does not produce indole as measured with Kovac's Reagent Indole Test. A T7 phage strain with a gp1 KO is available from the Whitehead Lab. Please visit https://doi.org/10.1101/2024.08.07.607023 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:31:50 | 0 | |
|
MG1655 Z1 malE clpA Resource Report Resource Website |
RRID:Addgene_65918 | MG1655 Z1 malE clpA | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, clpA- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:18:22 | 0 | ||
|
MG1655 Z1 malE aat Resource Report Resource Website |
RRID:Addgene_65917 | MG1655 Z1 malE aat | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, aat- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:18:22 | 0 | ||
|
TK310 Resource Report Resource Website |
RRID:Addgene_196340 | ΔcyaA ΔcpdA ΔlacY | n/a | None | PMID:17376875 | Primers: oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG oSK286, cpdA-rev: CACTGCGGGCAGCATAAA oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC oSK290, CyaA-rev: GCTGCACCAGGTATGGCT | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:34:26 | 0 | |
|
CZ105 Resource Report Resource Website |
RRID:Addgene_242527 | DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31] | E. coli | None | PMID:40493021 | Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:34:30 | 0 | ||
|
SB39 Resource Report Resource Website |
RRID:Addgene_235121 | Other | None | PMID:42199375 | Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:34:17 | 0 | ||
|
SHARK6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248174 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:35:12 | 1 | ||
|
SHARK8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248176 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:35:12 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
