Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: This is the NC1 strain (Addgene #215355) with a deletion of the camR gene.
Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional).
Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8.
Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1.
Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215356 Copy
Species: other
Genetic Insert: BBa_J23119-RiboJ-RBS(21992)-gfpmut3
Vector Backbone Description: Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Proper citation: RRID:Addgene_214746 Copy
Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214747 Copy
Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_214748 Copy
Species: n/a
Genetic Insert: exoI- recJ- araB::T7RNAP-tetA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Strain was validated by shotgun sequencing using Illumina Nextseq.
Supporting References:
Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6.
González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050.
Proper citation: RRID:Addgene_220588 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230042 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230041 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230040 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230035 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230039 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230036 Copy
Species: n/a
Genetic Insert: tnaA-
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:39610115
Comments: Derived from E. coli K-12 MG1655 strain. This strain does not produce indole as measured with Kovac's Reagent Indole Test. A T7 phage strain with a gp1 KO is available from the Whitehead Lab.
Please visit https://doi.org/10.1101/2024.08.07.607023 for bioRxiv preprint.
Proper citation: RRID:Addgene_228513 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt trpR::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of trpR knock-out:
Fwd - prEP184, gtatcactctctgctttattaccggcaa
Rev - prEP186, gcggcaataatggtgtcgat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229546 Copy
Species: n/a
Genetic Insert: none
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40595632
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C
To verify the gyrA gene using the following primers:
gyrA462-F: cccgtcgtactattttcgaac
gyrA462-R: cagcagtcggtcgataaagtc
The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference.
Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above.
Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.
Proper citation: RRID:Addgene_237425 Copy
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:42199375
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ]
Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT).
Strain validation:
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp.
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp.
- PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
Proper citation: RRID:Addgene_235121 Copy
Species: n/a
Genetic Insert: ΔcyaA ΔcpdA ΔlacY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:17376875
Comments: Primers:
oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG
oSK286, cpdA-rev: CACTGCGGGCAGCATAAA
oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG
oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC
oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC
oSK290, CyaA-rev: GCTGCACCAGGTATGGCT
Proper citation: RRID:Addgene_196340 Copy
Species: E. coli
Genetic Insert: DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31]
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:40493021
Proper citation: RRID:Addgene_242527 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248174 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248176 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.