Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
mcherry-PH Resource Report Resource Website 1+ mentions |
RRID:Addgene_36075 | PH domain of PLCdelta1 | Homo sapiens | Ampicillin | PMID:19936219 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 9 | ||
|
YFP-Gamma 9-3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36074 | G protein G9(gamma 3 tail) | Bos taurus | Ampicillin | PMID:19936219 | Mutagenesis was used to replace the last 15 residues of gamma 9 with those of gamma 3. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | HIs tag between YFP and insert | 2026-08-15 01:14:05 | 1 |
|
YFP Gamma 9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36107 | G protein subunit Gamma 9 | Bos taurus | Ampicillin | PMID:17581822 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | HIs tag between YFP and insert | 2026-08-15 01:14:05 | 1 | |
|
pCMV-Pax2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36052 | Pax2 | Mus musculus | Ampicillin | PMID:11032856 | Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 4 | ||
|
pAAV asyn WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_36055 | alpha-synuclein WT | Homo sapiens | Ampicillin | PMID:22302797 | Lashuel Lab Plasmid #172 | Backbone Marker:Stratagene; Backbone Size:4581; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 9 | |
|
ptp4a3_R (TAL 3001) Resource Report Resource Website 1+ mentions |
RRID:Addgene_35993 | TAL array targeting ptp4a3 | Danio rerio | Ampicillin | PMID:21822241 | Vector Backbone:JDS 70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:04 | 1 | ||
|
pcDNA3.1 MCS-BirA(R118G)-HA Resource Report Resource Website 50+ mentions |
RRID:Addgene_36047 | BirA(R118G)-HA | E. coli | Ampicillin | PMID:22412018 | Backbone Marker:Invitrogen; Backbone Size:5333; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R118G (highly promiscuous form) | 2026-08-15 01:14:08 | 64 | |
|
pT7-7 asyn WT Resource Report Resource Website 10+ mentions |
RRID:Addgene_36046 | alpha-synuclein | Homo sapiens | Ampicillin | PMID:18343814 | Lashuel Lab Plasmid #77 | Backbone Size:2438; Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 48 | |
|
YFP-Gamma 5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36044 | G protein subunit Gamma 5 | Rattus norvegicus | Ampicillin | PMID:16517125 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:05 | 1 | ||
|
pCDNA 3.1 Flag-rat-PTP1B Resource Report Resource Website 1+ mentions |
RRID:Addgene_35988 | protein tyrosine phosphatase 1B | Rattus norvegicus | Ampicillin | PMID:18332219 | A Kozak methionine initiator sequence and a Flag tag were added to the N terminus of rat PTP1B, which was amplified by PCR with the following primers: 5′-CTCGGATCCGCCACCATGGACTACAAGGACGACGATGACAAGAAGCTTGGGATGGAAATGGAGAAGGAATTCGAG-3′ and 5′-CTCTAGACTCGAGCGGCCGCTCAGTGAAAACATACCCGGTAACAG-3′. The PCR product was digested with BamHI and NotI and subsequently ligated into the corresponding sites of pCDNA3.1(+) (Invitrogen) Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 889-910, indicating that the NheI and AflII sites are no longer present in the plasmid. | Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:04 | 3 | |
|
CHOP promoter (-649/+136) pmCherry-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36035 | CHOP promoter (-647 to +136) | Homo sapiens | Kanamycin | PMID:22215663 | Backbone Marker:Clontech; Backbone Size:4140; Vector Backbone:pmCherry-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:08 | 7 | ||
|
pDRf1-GW Resource Report Resource Website 1+ mentions |
RRID:Addgene_36026 | Ampicillin | PMID:17293878 | Backbone Size:9100; Vector Backbone:pDRf1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:08 | 1 | ||||
|
pDR196 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36029 | Ampicillin | PMID:16407306 | Backbone Size:6400; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:08 | 4 | ||||
|
pRibo BsaHind Resource Report Resource Website 1+ mentions |
RRID:Addgene_36251 | Kanamycin | PMID:22279533 | The plasmid is high copy in E. coli, but low copy in mycobacteria. | Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:09 | 1 | |||
|
pRRL WS1.6 WASp Resource Report Resource Website 1+ mentions |
RRID:Addgene_36250 | WASp | Homo sapiens | Ampicillin | PMID:22431569 | Backbone Marker:Didier Trono; Backbone Size:6857; Vector Backbone:pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:06 | 1 | ||
|
TBRE-TK-Luc-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_36246 | Two copies of the Brachyury T-box site | Ampicillin | PMID:22354841 | Brachyury palindromic element: AATTTCACACCTAGGTGTGAAATT | Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:06 | 2 | ||
|
TBRE-TK-Luc-MUT Resource Report Resource Website 1+ mentions |
RRID:Addgene_36245 | Two copies of the Brachyury T-box site | Ampicillin | PMID:22354841 | Mutated Brachyury palindromic element: AATTTGGGACCTAGGTCCCAAATT | Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Mutations in the Brachyury palindromic element:CAC-->GGG and GTG-->CCC | 2026-08-15 01:14:09 | 2 | |
|
DOT1L Resource Report Resource Website 1+ mentions |
RRID:Addgene_36196 | DOT1L (GeneScript Synthesized) | Homo sapiens | Kanamycin | PDB: 3SX0. http://www.thesgc.org/structures/3SX0/ PDB: 5JUW. http://www.thesgc.org/structures/5JUW/ | Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | contains amino acid residues 1-420 | 2026-08-15 01:14:06 | 2 | |
|
ITCH Resource Report Resource Website 1+ mentions |
RRID:Addgene_36197 | ITCH | Homo sapiens | Kanamycin | PDB: 3TUG. http://www.thesgc.org/structures/3TUG/ | Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | contains HECT domain | 2026-08-15 01:14:06 | 1 | |
|
pEGFP.N1-HDAC6.DC (catalytic deficient) Resource Report Resource Website 1+ mentions |
RRID:Addgene_36189 | HDAC6.DC | Homo sapiens | Kanamycin | PMID:20133936 | Additional Reference: Gao etal "Histone Deacetylase 6 Regulates Growth Factor-Induced Actin Remodeling and Endocytosis" MOLECULAR AND CELLULAR BIOLOGY, Dec. 2007, p. 8637–8647 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | H216/611A | 2026-08-15 01:14:08 | 4 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
