Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: PH domain of PLCdelta1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19936219
Proper citation: RRID:Addgene_36075 Copy
Species: Bos taurus
Genetic Insert: G protein G9(gamma 3 tail)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19936219
Comments: Mutagenesis was used to replace the last 15 residues of gamma 9 with those of gamma 3.
Proper citation: RRID:Addgene_36074 Copy
Species: Bos taurus
Genetic Insert: G protein subunit Gamma 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36107 Copy
Species: Mus musculus
Genetic Insert: Pax2
Vector Backbone Description: Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11032856
Proper citation: RRID:Addgene_36052 Copy
Species: Homo sapiens
Genetic Insert: alpha-synuclein WT
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4581; Vector Backbone:pAAV-MCS; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22302797
Comments: Lashuel Lab Plasmid #172
Proper citation: RRID:Addgene_36055 Copy
Species: Danio rerio
Genetic Insert: TAL array targeting ptp4a3
Vector Backbone Description: Vector Backbone:JDS 70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Proper citation: RRID:Addgene_35993 Copy
Species: E. coli
Genetic Insert: BirA(R118G)-HA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5333; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22412018
Proper citation: RRID:Addgene_36047 Copy
Species: Homo sapiens
Genetic Insert: alpha-synuclein
Vector Backbone Description: Backbone Size:2438; Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18343814
Comments: Lashuel Lab Plasmid #77
Proper citation: RRID:Addgene_36046 Copy
Species: Rattus norvegicus
Genetic Insert: G protein subunit Gamma 5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16517125
Proper citation: RRID:Addgene_36044 Copy
Species: Rattus norvegicus
Genetic Insert: protein tyrosine phosphatase 1B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18332219
Comments: A Kozak methionine initiator sequence and a Flag tag were added to the N terminus of rat PTP1B, which was amplified by PCR with the following primers: 5′-CTCGGATCCGCCACCATGGACTACAAGGACGACGATGACAAGAAGCTTGGGATGGAAATGGAGAAGGAATTCGAG-3′ and 5′-CTCTAGACTCGAGCGGCCGCTCAGTGAAAACATACCCGGTAACAG-3′. The PCR product was digested with BamHI and NotI and subsequently ligated into the corresponding sites of pCDNA3.1(+) (Invitrogen)
Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 889-910, indicating that the NheI and AflII sites are no longer present in the plasmid.
Proper citation: RRID:Addgene_35988 Copy
Species: Homo sapiens
Genetic Insert: CHOP promoter (-647 to +136)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4140; Vector Backbone:pmCherry-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22215663
Proper citation: RRID:Addgene_36035 Copy
Vector Backbone Description: Backbone Size:9100; Vector Backbone:pDRf1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17293878
Proper citation: RRID:Addgene_36026 Copy
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407306
Proper citation: RRID:Addgene_36029 Copy
Vector Backbone Description: Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22279533
Comments: The plasmid is high copy in E. coli, but low copy in mycobacteria.
Proper citation: RRID:Addgene_36251 Copy
Species: Homo sapiens
Genetic Insert: WASp
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:6857; Vector Backbone:pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431569
Proper citation: RRID:Addgene_36250 Copy
Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Brachyury palindromic element:
AATTTCACACCTAGGTGTGAAATT
Proper citation: RRID:Addgene_36246 Copy
Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Mutated Brachyury palindromic element:
AATTTGGGACCTAGGTCCCAAATT
Proper citation: RRID:Addgene_36245 Copy
Species: Homo sapiens
Genetic Insert: DOT1L (GeneScript Synthesized)
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3SX0. http://www.thesgc.org/structures/3SX0/
PDB: 5JUW. http://www.thesgc.org/structures/5JUW/
Proper citation: RRID:Addgene_36196 Copy
Species: Homo sapiens
Genetic Insert: ITCH
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3TUG. http://www.thesgc.org/structures/3TUG/
Proper citation: RRID:Addgene_36197 Copy
Species: Homo sapiens
Genetic Insert: HDAC6.DC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20133936
Comments: Additional Reference:
Gao etal "Histone Deacetylase 6 Regulates Growth Factor-Induced Actin Remodeling and Endocytosis" MOLECULAR AND CELLULAR BIOLOGY, Dec. 2007, p. 8637–8647
Proper citation: RRID:Addgene_36189 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
