Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pYES2.1-cerMET14
 
Resource Report
Resource Website 		RRID:Addgene_107441 MET14 Saccharomyces cerevisiae Ampicillin PMID:29326101 contains the coding sequence for adenylylsulfate kinase Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:10 0
pYES2.1-cerMET10
 
Resource Report
Resource Website 		RRID:Addgene_107440 MET10 Saccharomyces cerevisiae Ampicillin PMID:29326101 contains the coding sequence for the alpha subunit of sulfite reductase Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:10 0
pROS17
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107931 gRNA-CAN1.Y, gRNA-ADE2.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5280; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 1
pROS15
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107929 gRNA-CAN1.Y, gRNA-ADE2.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5660; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 1
pROS13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107927 gRNA-CAN1.Y, gRNA-ADE2.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5817; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 1
pROS10
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107924 gRNA-CAN1.Y, gRNA-ADE2.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5577; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 1
pMEL17
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107923 gRNA-CAN1.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5593; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 1
pMEL16
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_107922 gRNA-CAN1.Y Saccharomyces cerevisiae Ampicillin PMID:25743786 Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5775; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:01:15 3
pBV163
 
Resource Report
Resource Website 		RRID:Addgene_108364 Knock-in Cg TDH3 promoter in Cg YAP1 gene Saccharomyces cerevisiae Ampicillin PMID:29600281 Backbone Size:2648; Vector Backbone:pFA6a; Vector Types:Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter; Bacterial Resistance:Ampicillin 2026-08-15 01:01:19 0
pCAGGS-6011nes
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_108652 hyBRET-ERK-EV Saccharomyces cerevisiae Ampicillin PMID:29895862 Backbone Size:4739; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:21 3
pJCSUP35
 
Resource Report
Resource Website 		RRID:Addgene_1088 SUP35 Saccharomyces cerevisiae Ampicillin PMID:9182769 Backbone Marker:J. Clos and Brandau, 1994; Backbone Size:0; Vector Backbone:pJC45; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:01:23 0
pRRP51A+intron-LacZ (pHZ18)
 
Resource Report
Resource Website 		RRID:Addgene_33131 RP51A+intron-LacZ Saccharomyces cerevisiae Ampicillin PMID:6308621 GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:52 0
pLG-Sty
 
Resource Report
Resource Website 		RRID:Addgene_33149 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG 2026-08-15 01:13:47 0
pLG-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33148 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC 2026-08-15 01:13:47 0
Gal-Rad51 KR
 
Resource Report
Resource Website 		RRID:Addgene_33232 Rad51 Saccharomyces cerevisiae Ampicillin PMID:20864034 Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin K191R 2026-08-15 01:13:47 0
Gal-Rad51
 
Resource Report
Resource Website 		RRID:Addgene_33230 Rad51 Saccharomyces cerevisiae Ampicillin PMID:20864034 Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:47 0
pLG-Nde-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33150 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC, and NdeI site after intron was cut/filled and a BamHI linker was inserted to obtain the appropriate reading frame changing CATATG to CATACGGGATCC 2026-08-15 01:13:53 0
pLG-deltaA
 
Resource Report
Resource Website 		RRID:Addgene_33151 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin The RP51A sequence was modified by digestion with StyI and HincII, filled in and ligated to delete ~27bp including the 5' splice site 2026-08-15 01:13:47 0
P413TEF-PYK1
 
Resource Report
Resource Website 		RRID:Addgene_34605 PYK1 Saccharomyces cerevisiae Ampicillin PMID:21907146 Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:53 0
p416GPD-PYK1
 
Resource Report
Resource Website 		RRID:Addgene_34604 PYK1 Saccharomyces cerevisiae Ampicillin PMID:21907146 Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:01 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch