Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-26t plus, OsU3p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50595 Copy
Species: Synthetic
Genetic Insert: T1, U626t plus, U629p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50590 Copy
Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-1tplus, U6-26p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50592 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mTurquoise2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50635 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mRuby2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50633 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mRuby2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50645 Copy
Species: Synthetic
Genetic Insert: 3xGFP
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12566428
Comments: Please note that this plasmid is unstable due to the tandem yeGFP genes. Screening of colonies is required prior to storage. See diagnostic digest for expected results.
Proper citation: RRID:Addgene_50659 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CloverGFP-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50654 Copy
Genetic Insert: sgAAVS1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction)
gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_50662 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: Depositors used delta-VPR and CMV VSV-G packaging plasmids
Proper citation: RRID:Addgene_50661 Copy
Species: Homo sapiens
Genetic Insert: EWSR1 G511A
Vector Backbone Description: Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22454397
Proper citation: RRID:Addgene_50734 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Iain Fraser(Addgene plasmid #25735); Backbone Size:13286; Vector Backbone:pSLIK-neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22454397
Proper citation: RRID:Addgene_50733 Copy
Species: Homo sapiens
Genetic Insert: CrkII
Vector Backbone Description: Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50730 Copy
Genetic Insert: gene encoding for MagFRET-1
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24312622
Proper citation: RRID:Addgene_50742 Copy
Species: Homo sapiens
Genetic Insert: Cdc42BPB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24019534
Proper citation: RRID:Addgene_50759 Copy
Species: P. falciparum
Genetic Insert: MSP3.5
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24620899
Comments: Made by gene synthesis
Proper citation: RRID:Addgene_50803 Copy
Species: P. falciparum
Genetic Insert: MSRP5
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24620899
Comments: Made by gene synthesis
Proper citation: RRID:Addgene_50805 Copy
Species: Xanthamonas oryzae
Genetic Insert: TALEN-FokI nuclease backbone
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50700 Copy
Species: Mus musculus
Genetic Insert: Klf1
Vector Backbone Description: Backbone Marker:Yamanaka Lab, Addgene plasmid #18656; Backbone Size:4750; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18059259
Proper citation: RRID:Addgene_50785 Copy
Species: Xanthamonas oryzae
Genetic Insert: TALEN-FokI nuclease backbone
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550
Proper citation: RRID:Addgene_50704 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
