Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 100 showing 1981 ~ 2000 out of 69,553 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_102878

http://www.addgene.org/102878

Species: Homo sapiens
Genetic Insert: Human platelet membrane protein GPIb alpha 1-290aa
Vector Backbone Description: Backbone Size:5374; Vector Backbone:ET8; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28831047

Proper citation: RRID:Addgene_102878 Copy   


http://www.addgene.org/102854

Species: Homo sapiens
Genetic Insert: sp-TRE3G-sgRNA; mTagBFP2
Vector Backbone Description: Vector Backbone:PX462; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28938067

Proper citation: RRID:Addgene_102854 Copy   


  • RRID:Addgene_102957

http://www.addgene.org/102957

Species: Homo sapiens
Genetic Insert: MR1A cDNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3908; Vector Backbone:pCR2.1-TOPO; Vector Types:Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24832684

Proper citation: RRID:Addgene_102957 Copy   


  • RRID:Addgene_103061

http://www.addgene.org/103061

Species: Homo sapiens
Genetic Insert: integration of Cas9 with guide targeting GESTALT barcodes V1 to V5
Vector Backbone Description: Vector Backbone:lentiCRISPR v2 (#52961); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27229144
Comments: Derived from pX330-U6-Chimeric_BB-CBh-hSpCas9

Proper citation: RRID:Addgene_103061 Copy   


  • RRID:Addgene_103062

    This resource has 1+ mentions.

http://www.addgene.org/103062

Species: Homo sapiens
Genetic Insert: Cas9 plus expressed GESTALT V1-V5 guide
Vector Backbone Description: Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27229144
Comments: Derived from https://www.addgene.org/52961/

Proper citation: RRID:Addgene_103062 Copy   


http://www.addgene.org/102994

Species: Homo sapiens
Genetic Insert: H2B-GCaMP6f
Vector Backbone Description: Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29736000

Proper citation: RRID:Addgene_102994 Copy   


http://www.addgene.org/102995

Species: Homo sapiens
Genetic Insert: H2B-jRGECO1a
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30952812
Comments: Please visit https://www.biorxiv.org/content/10.1101/433953v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_102995 Copy   


http://www.addgene.org/102996

Species: Homo sapiens
Genetic Insert: Synaptophysin-GCaMP6f
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102996 Copy   


  • RRID:Addgene_102968

http://www.addgene.org/102968

Species: Homo sapiens
Genetic Insert: shABCB7_1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000059355

Proper citation: RRID:Addgene_102968 Copy   


  • RRID:Addgene_102969

http://www.addgene.org/102969

Species: Homo sapiens
Genetic Insert: shABCB7_2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000059356

Proper citation: RRID:Addgene_102969 Copy   


  • RRID:Addgene_102964

    This resource has 1+ mentions.

http://www.addgene.org/102964

Species: Homo sapiens
Genetic Insert: shNFS1_2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000229755

Proper citation: RRID:Addgene_102964 Copy   


  • RRID:Addgene_102966

    This resource has 1+ mentions.

http://www.addgene.org/102966

Species: Homo sapiens
Genetic Insert: shNFS1_4
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000180881

Proper citation: RRID:Addgene_102966 Copy   


  • RRID:Addgene_102970

http://www.addgene.org/102970

Species: Homo sapiens
Genetic Insert: shFXN_1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000006138

Proper citation: RRID:Addgene_102970 Copy   


  • RRID:Addgene_102976

    This resource has 1+ mentions.

http://www.addgene.org/102976

Species: Homo sapiens
Genetic Insert: shSOD2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000005943

Proper citation: RRID:Addgene_102976 Copy   


  • RRID:Addgene_102977

http://www.addgene.org/102977

Species: Homo sapiens
Genetic Insert: NFS1
Vector Backbone Description: Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506

Proper citation: RRID:Addgene_102977 Copy   


  • RRID:Addgene_102978

http://www.addgene.org/102978

Species: Homo sapiens
Genetic Insert: NFS1 C381A
Vector Backbone Description: Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506

Proper citation: RRID:Addgene_102978 Copy   


  • RRID:Addgene_102971

http://www.addgene.org/102971

Species: Homo sapiens
Genetic Insert: shFXN_2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000006137

Proper citation: RRID:Addgene_102971 Copy   


  • RRID:Addgene_102972

    This resource has 1+ mentions.

http://www.addgene.org/102972

Species: Homo sapiens
Genetic Insert: shISCU
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000289988

Proper citation: RRID:Addgene_102972 Copy   


  • RRID:Addgene_102973

http://www.addgene.org/102973

Species: Homo sapiens
Genetic Insert: shMOCS3_1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000045642

Proper citation: RRID:Addgene_102973 Copy   


  • RRID:Addgene_103194

http://www.addgene.org/103194

Species: Homo sapiens
Genetic Insert: hsa-miR-127-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103194 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X