Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Parkin 77-465
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45970 Copy
Species: Rattus norvegicus
Genetic Insert: Parkin 141-465
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45971 Copy
Species: Rattus norvegicus
Genetic Insert: Parkin W403A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45974 Copy
Species: Rattus norvegicus
Genetic Insert: Parkin C431S
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45976 Copy
Species: Rattus norvegicus
Genetic Insert: Jag1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23419361
Proper citation: RRID:Addgene_46052 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b motor domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4694; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26195670
Comments: PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT
Proper citation: RRID:Addgene_187364 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 2
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233
Proper citation: RRID:Addgene_186688 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP3-44
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28162809
Proper citation: RRID:Addgene_91780 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP6-210
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28162809
Proper citation: RRID:Addgene_91778 Copy
Species: Rattus norvegicus
Genetic Insert: rM3D
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28712653
Proper citation: RRID:Addgene_92285 Copy
Species: Rattus norvegicus
Genetic Insert: Stx4
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818
Proper citation: RRID:Addgene_92427 Copy
Species: Rattus norvegicus
Genetic Insert: Stx3
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818
Proper citation: RRID:Addgene_92428 Copy
Species: Rattus norvegicus
Genetic Insert: Stx3
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818
Proper citation: RRID:Addgene_92421 Copy
Species: Rattus norvegicus
Genetic Insert: Stx4
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818
Proper citation: RRID:Addgene_92422 Copy
Species: Rattus norvegicus
Genetic Insert: Lysosome-associated membrane glycoprotein 1
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing.
This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342
Proper citation: RRID:Addgene_185138 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33237838
Comments: Please note there is a single mutation in sfGFP-D117Y. Depositor confirms this is not a concern for plasmid function.
Proper citation: RRID:Addgene_164478 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1-miRFP670nano3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35606446
Proper citation: RRID:Addgene_184669 Copy
Species: Rattus norvegicus
Genetic Insert: AP180
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35852853
Comments: Please note: The plasmid is difficult to sequence near bases 2140-2220 that are within the insert.
Proper citation: RRID:Addgene_186577 Copy
Species: Rattus norvegicus
Genetic Insert: Double C2 protein beta
Vector Backbone Description: Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31147445
Proper citation: RRID:Addgene_134690 Copy
Species: Rattus norvegicus
Genetic Insert: Double C2 protein beta
Vector Backbone Description: Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31147445
Proper citation: RRID:Addgene_134691 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
