Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:Addgene # 55641; Backbone Size:6323; Vector Backbone:pAAV-Ef1a-fDIO; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35984878
Proper citation: RRID:Addgene_128434 Copy
Vector Backbone Description: Backbone Size:2739; Vector Backbone:pTAKN-2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_128433 Copy
Species: Synthetic
Genetic Insert: C-terminal HA tag
Vector Backbone Description: Backbone Marker:Cell Biolabs, Inc; Backbone Size:4796; Vector Backbone:pSMPUW-eMCS; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Kanamycin
Proper citation: RRID:Addgene_128439 Copy
Species: E. coli
Genetic Insert: Maltose binding protein
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Comments: Depositor confirms mutation does not affect plasmid function.
Proper citation: RRID:Addgene_128390 Copy
Species: N. meningitidis
Genetic Insert: PorA
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128392 Copy
Species: H. influenzae
Genetic Insert: Protein D
Vector Backbone Description: Backbone Size:1765; Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33536221
Proper citation: RRID:Addgene_128391 Copy
Species: Homo sapiens
Genetic Insert: NLuc398-3xGGGGS-LGALS8
Vector Backbone Description: Backbone Marker:VectorBuilder; Backbone Size:7344; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32573202
Proper citation: RRID:Addgene_128387 Copy
Species: Homo sapiens
Genetic Insert: NLuc-3xGGGGS-Gal8-NCRD
Vector Backbone Description: Backbone Marker:VectorBuilder; Backbone Size:9096; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32573202
Proper citation: RRID:Addgene_128386 Copy
Species: Homo sapiens
Genetic Insert: FucciOrange
Vector Backbone Description: Backbone Size:4093; Vector Backbone:PCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31233018
Proper citation: RRID:Addgene_128427 Copy
Species: Homo sapiens
Genetic Insert: CyclinB1-GFP
Vector Backbone Description: Backbone Size:4093; Vector Backbone:PCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31233018
Proper citation: RRID:Addgene_128426 Copy
Species: Arabidopsis thaliana
Genetic Insert: TESTA ABUNDANT 2
Vector Backbone Description: Backbone Marker:Invitrogen modified by doi:10.1271/bbb.70678; Backbone Size:5892; Vector Backbone:pDONRG_P4-P1R; Vector Types:Gateway promoter entry clone; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31422517
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_128429 Copy
Species: Bertholletia excelsa
Genetic Insert: mutant Ber e 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8016; Vector Backbone:pPIC9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: secreted Ber e 1 from Brazil nut mutant S110A
Proper citation: RRID:Addgene_128530 Copy
Species: Homo sapiens
Genetic Insert: A2M (G27-A788)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4396; Vector Backbone:pCMV-Sport 6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31235767
Proper citation: RRID:Addgene_128496 Copy
Species: Homo sapiens
Genetic Insert: A2M (G27-S1468)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4396; Vector Backbone:pCMV-Sport 6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31235767
Proper citation: RRID:Addgene_128495 Copy
Species: Bertholletia excelsa
Genetic Insert: mutant Ber e 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8016; Vector Backbone:pPIC9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: secreted Ber e 1 from Brazil nut mutant C62A
Proper citation: RRID:Addgene_128534 Copy
Species: Streptococcus pyogenes serotype M1
Genetic Insert: GRAB (V34-N181)
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5369; Vector Backbone:pCri8a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31235767
Comments: Reverse primer 1: CGAATTGTGGATGGCTCCAACCTCCATTAACGTTCTGACGTTC
Reverse primer 2: CTTCCACCTCCAGAACCTCCACCCTTTTCGAATTGTGGATGGCTCC3
Reverse primer 3: GTGGATGGCTCCATGCGCTACCTCCACTTCCACCTCCAGAAC
Proper citation: RRID:Addgene_128499 Copy
Species: Bertholletia excelsa
Genetic Insert: mutant Ber e 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8016; Vector Backbone:pPIC9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: secreted Ber e 1 from Brazil nut mutant C08A
Proper citation: RRID:Addgene_128532 Copy
Species: Streptococcus pyogenes serotype M1
Genetic Insert: GRAB (Streptococcus pyogenes serotype M1)
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5369; Vector Backbone:pCri8a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31235767
Proper citation: RRID:Addgene_128498 Copy
Species: Bertholletia excelsa
Genetic Insert: mutant Ber e 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8016; Vector Backbone:pPIC9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: secreted Ber e 1 from Brazil nut mutant T33A T36A
Proper citation: RRID:Addgene_128531 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf161
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12849 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
