Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: EB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5443; Vector Backbone:tdTomato-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: We received the EB1 construct from Yuko Mimori-Kiyosue (RIKEN, Kobe, Japan) originally and replaced the GFP with tdTomato.
There is a 4x Gly linker between the EB1 and the tdTomato.
Proper citation: RRID:Addgene_50825 Copy
Species: Synthetic
Genetic Insert: rTetR DNA binding domain-GBP1 fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_50791 Copy
Species: Synthetic
Genetic Insert: two-copy Pyl tRNA cassette
Vector Backbone Description: Vector Backbone:pAcBac; Vector Types:Insect Expression, baculoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23818609
Proper citation: RRID:Addgene_50832 Copy
Species: Synthetic
Genetic Insert: GBP6-VPminx4 activation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Note that GBP6 was verified in Addgene's quality control sequencing but cannot be displayed.
Proper citation: RRID:Addgene_50796 Copy
Species: Other
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Liqun Luo; Backbone Size:2959; Vector Backbone:pUAS-luc2; Vector Types:Multi-species; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_50797 Copy
Species: Synthetic
Genetic Insert: split EGFP
Vector Backbone Description: Backbone Size:5138; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24284873
Proper citation: RRID:Addgene_50716 Copy
Species: Mus musculus
Genetic Insert: Cetn1
Vector Backbone Description: Backbone Size:6383; Vector Backbone:pCAG-EGxxFP; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24284873
Proper citation: RRID:Addgene_50717 Copy
Species: Synthetic
Genetic Insert: ddGFP A and ddGFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Proper citation: RRID:Addgene_50842 Copy
Species: Homo sapiens
Genetic Insert: cofilin 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18045906
Comments: Human cofilin 1 cDNA was PCRed with a 5' primer that had an EcoRI, while the 3' primer had KpnI and EcoRV. EcoRI and KpnI were then used to ligate into pcDNA3.1- (leaving the EcoRV on the 3’ end of the insert).
Forward primer sequence: CGGAATTCACCACCATGGCCTCCGGTGTGGCTGTCTC.
Reverse primer sequence: GGGGTACCGATATCCTCACAAAGGCTTGCCCTCCAGG.
Proper citation: RRID:Addgene_50853 Copy
Species: Homo sapiens
Genetic Insert: cofilin 1 S3A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18045906
Proper citation: RRID:Addgene_50860 Copy
Species: Homo sapiens
Genetic Insert: cofilin 1 S3E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18045906
Proper citation: RRID:Addgene_50861 Copy
Species: S. pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function.
Proper citation: RRID:Addgene_50918 Copy
Species: S. pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function.
Proper citation: RRID:Addgene_50916 Copy
Species: synthetic
Genetic Insert: negative control sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested.
Proper citation: RRID:Addgene_50927 Copy
Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50930 Copy
Species: Homo sapiens
Genetic Insert: PML-3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10779416
Proper citation: RRID:Addgene_50939 Copy
Species: Homo sapiens
Genetic Insert: PTEN 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22000013
Comments: Primers used to amplify the 3'UTR of PTEN:
PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA,
PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,
Proper citation: RRID:Addgene_50936 Copy
Species: Homo sapiens
Genetic Insert: RanGTPase activating protein 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22464730
Proper citation: RRID:Addgene_50941 Copy
Genetic Insert: PHAkt
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Proper citation: RRID:Addgene_50837 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB 1-908
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Comments: Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106)
Proper citation: RRID:Addgene_50839 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
