Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: Loquacious-PA
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41108 Copy
Species: Synthetic
Genetic Insert: taranismutant3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41107 Copy
Species: Synthetic
Genetic Insert: taranis3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41106 Copy
Species: Synthetic
Genetic Insert: Gk3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41104 Copy
Species: Synthetic
Genetic Insert: 8xmiR307_21nt-seedonly
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41103 Copy
Species: Homo sapiens
Genetic Insert: Tetherin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7162; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20140192
Comments: This is a viral-delivery-compatible HA.Tetherin expression construct. It was generated by cloning of tetherin from plasmid pCMV-HA.Tetherin (Addgene plasmid #41068) into AgeI and PacI restriction sites of pQCXIP (Clontech).
Proper citation: RRID:Addgene_41069 Copy
Vector Backbone Description: Backbone Size:3726; Vector Backbone:pTKIP; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20047970
Proper citation: RRID:Addgene_41067 Copy
Species: Synthetic
Genetic Insert: 4xmiR307_23nt-seedonly
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41100 Copy
Vector Backbone Description: Backbone Size:4146; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20047970
Proper citation: RRID:Addgene_41065 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-bsx-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TATCTCTGGATCTCGAAC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41209 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-bmp10-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAGCTCCCCGGAGAGGC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41206 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-bbc3-(puma)-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGCCAGGCGTCCTGACG
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41205 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-avpr1b-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGGCCACATCTTCGTTC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41203 Copy
Species: Homo sapiens
Genetic Insert: PBD HK-AA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/3x myc-C; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16267267
Comments: Addgene plasmid #41162: Plk1-PBDWT (aa 326–603) was cloned in-frame by PCR into a pcDNA3.1 vector encoding an amino-terminal 3xmyc-tag (Invitrogen, Carlsbad, CA) using primers 5'-CCG GAA TTC CAG ATC TTC GAT TGC TCC CAG CAG CCT GG-3' and
5'-CCG CTC GAG TTA GGA GGC CTT GAG ACG GTT GC-3'.
The Plk1-PBDAA mutant (H538A, K540A) was made by site-directed mutagenesis using the following primers: 5'-CAA TTC TCC GGA GCC CCG CCT ATC TGT CCC-3' and 5'-GGG ACA GAT AGG CGG GGC TCC GGA GAA TTG-3'.
Proper citation: RRID:Addgene_41161 Copy
Species: Homo sapiens
Genetic Insert: Plk1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5527; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7962193
Comments: cDNA fragments spanning parts of the catalytic domains of human protein kinases were amplified by PCR, as described by Schultz and Nigg (1993). A 144 bp fragment (named HsPK28) showing 88% nucleotide identity to Drosophila polo was used to probe a λgt 10 library prepared from a human nasopharyngeal carcinoma (Hitt et al., 1989). Approximately 500,000 plaques were screened by plaque hybridization (Sambrook et al., 1989), and 17 phage showing strong hybridization were purified. DNA was prepared using Lambdasorb (Promega Biotech, Madison, WI).
One plasmid (referred to as Plk1-pGEM) with a 2143 bp insert contained the entire coding sequence for a protein kinase closely related to Drosophila polo. This insert was sequenced on both strands by the method of Chen and Seeburg (1985), using the Sequenase kit (United States Biochemicals).
To express a full-length Plk1 protein, the 1998 bp fragment of Plk1-pGEM was introduced into the pRc/CMV vector (Invitrogen Corporation, San Diego), to create Plk1-CMV. An N-terminally myc-tagged Plk1-CMV was also constructed. In the resulting mycplk1 protein, the N terminus of Plk1 is extended by the oligopeptide MEQKLISEEDLNMNSCSPGS (Evan et al., 1985).
Proper citation: RRID:Addgene_41160 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-avpr1b-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCACGGCGAACAACACTA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41202 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-arap3a-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGCAACAATCGGTCCGT
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41200 Copy
Species: Homo sapiens
Genetic Insert: Rootletin
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16203858
Comments: The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing.
Proper citation: RRID:Addgene_41166 Copy
Species: Homo sapiens
Genetic Insert: PICH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17218258
Comments: The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.
Proper citation: RRID:Addgene_41163 Copy
Species: Homo sapiens
Genetic Insert: Cep215
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18042621
Comments: The Cep215 cDNA sequence was obtained from KIAA1633 clone (from Kazusa DNA Research Institute). Using PCR, a frameshift within the sequence was corrected and missing 5' coding information was obtained by PCR amplification from Marathon cDNA library (Clontech). Constructs were fused to yield the complete coding sequence of Cep215, and subcloned into a mammalian expression vector providing a Myc epitope-tag. All constructs were confirmed by sequencing.
Proper citation: RRID:Addgene_41152 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.