Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX-parkin 77-465 Resource Report Resource Website |
RRID:Addgene_45970 | Parkin 77-465 | Rattus norvegicus | Ampicillin | PMID:23661642 | Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Codon usage optimized for E.coli expression. Deleted a.a. 1-76 | 2026-08-15 01:15:27 | 0 | |
|
pGEX-parkin 141-465 Resource Report Resource Website |
RRID:Addgene_45971 | Parkin 141-465 | Rattus norvegicus | Ampicillin | PMID:23661642 | Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Codon usage optimized for E.coli expression. Deleted a.a. 1-140 | 2026-08-15 01:15:27 | 0 | |
|
pGEX-parkin W403A Resource Report Resource Website |
RRID:Addgene_45974 | Parkin W403A | Rattus norvegicus | Ampicillin | PMID:23661642 | Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Codon usage optimized for E.coli expression. Changed Trp403 to alanine. | 2026-08-15 01:15:28 | 0 | |
|
pGEX-parkin C431S Resource Report Resource Website |
RRID:Addgene_45976 | Parkin C431S | Rattus norvegicus | Ampicillin | PMID:23661642 | Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Codon usage optimized for E.coli expression. Changed Cys431 to alanine. | 2026-08-15 01:15:28 | 0 | |
|
pENTR1A-HA-Jag1 Resource Report Resource Website |
RRID:Addgene_46052 | Jag1 | Rattus norvegicus | Kanamycin | PMID:23419361 | Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:28 | 0 | ||
|
EGFP-Myo1b motor Resource Report Resource Website |
RRID:Addgene_187364 | myosin 1b isoform b motor domain | Rattus norvegicus | Kanamycin | PMID:26195670 | PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT | Backbone Marker:Clontech; Backbone Size:4694; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:36 | 0 | |
|
Syt2 Resource Report Resource Website |
RRID:Addgene_186688 | Synaptotagmin 2 | Rattus norvegicus | Ampicillin | PMID:35322233 | Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:54 | 0 | ||
|
pGP-CMV-GCaMP3-44 Resource Report Resource Website |
RRID:Addgene_91780 | GCaMP3-44 | Rattus norvegicus | Kanamycin | PMID:28162809 | Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:24 | 0 | ||
|
pGP-CMV-GCaMP6-210 Resource Report Resource Website |
RRID:Addgene_91778 | GCaMP6-210 | Rattus norvegicus | Kanamycin | PMID:28162809 | Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:23 | 0 | ||
|
pZac2.1 GfaABC1D rM3D mCherry SV40 Resource Report Resource Website 1+ mentions |
RRID:Addgene_92285 | rM3D | Rattus norvegicus | Ampicillin | PMID:28712653 | Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:22:29 | 2 | ||
|
FKBP-Stx4-mCitrine Resource Report Resource Website |
RRID:Addgene_92427 | Stx4 | Rattus norvegicus | Kanamycin | PMID:28524818 | Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:30 | 0 | ||
|
FKBP-Stx3-mCitrine Resource Report Resource Website |
RRID:Addgene_92428 | Stx3 | Rattus norvegicus | Kanamycin | PMID:28524818 | Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:30 | 0 | ||
|
Stx3-pmCitrine Resource Report Resource Website |
RRID:Addgene_92421 | Stx3 | Rattus norvegicus | Kanamycin | PMID:28524818 | Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:30 | 0 | ||
|
Stx4-pmCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_92422 | Stx4 | Rattus norvegicus | Kanamycin | PMID:28524818 | Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:22:30 | 1 | ||
|
pcDNA3_mScarlet-LAMP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_185138 | Lysosome-associated membrane glycoprotein 1 | Rattus norvegicus | Ampicillin | Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing. This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342 | Backbone Marker:Thermo Fisher Scientific; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 1-21 of LAMP1 | 2026-08-15 01:23:18 | 2 | |
|
pLenti sfGFP-LAMP1-mCherry (pHLARE) Resource Report Resource Website 1+ mentions |
RRID:Addgene_164478 | LAMP1 | Rattus norvegicus | Ampicillin | PMID:33237838 | Please note there is a single mutation in sfGFP-D117Y. Depositor confirms this is not a concern for plasmid function. | Backbone Size:6900; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:22 | 2 | |
|
pLAMP1-miRFP670nano3 Resource Report Resource Website |
RRID:Addgene_184669 | LAMP1-miRFP670nano3 | Rattus norvegicus | Kanamycin | PMID:35606446 | Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:22 | 0 | ||
|
FKBP-AP180-GFP Resource Report Resource Website |
RRID:Addgene_186577 | AP180 | Rattus norvegicus | Kanamycin | PMID:35852853 | Please note: The plasmid is difficult to sequence near bases 2140-2220 that are within the insert. | Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:27 | 0 | |
|
pGEX-4T Doc2beta C2AB(125) WT Resource Report Resource Website |
RRID:Addgene_134690 | Double C2 protein beta | Rattus norvegicus | Ampicillin | PMID:31147445 | Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:08 | 0 | ||
|
pGEX-4T Doc2beta C2AB(125) H158C Resource Report Resource Website |
RRID:Addgene_134691 | Double C2 protein beta | Rattus norvegicus | Ampicillin | PMID:31147445 | Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | H158C, C145A, C217A, C249A, C290A, C338A, C387A | 2026-08-15 01:23:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.