Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:rattus norvegicus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

2,177 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGEX-parkin 77-465
 
Resource Report
Resource Website
RRID:Addgene_45970 Parkin 77-465 Rattus norvegicus Ampicillin PMID:23661642 Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon usage optimized for E.coli expression. Deleted a.a. 1-76 2026-08-15 01:15:27 0
pGEX-parkin 141-465
 
Resource Report
Resource Website
RRID:Addgene_45971 Parkin 141-465 Rattus norvegicus Ampicillin PMID:23661642 Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon usage optimized for E.coli expression. Deleted a.a. 1-140 2026-08-15 01:15:27 0
pGEX-parkin W403A
 
Resource Report
Resource Website
RRID:Addgene_45974 Parkin W403A Rattus norvegicus Ampicillin PMID:23661642 Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon usage optimized for E.coli expression. Changed Trp403 to alanine. 2026-08-15 01:15:28 0
pGEX-parkin C431S
 
Resource Report
Resource Website
RRID:Addgene_45976 Parkin C431S Rattus norvegicus Ampicillin PMID:23661642 Backbone Marker:Amersham; Backbone Size:4966; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon usage optimized for E.coli expression. Changed Cys431 to alanine. 2026-08-15 01:15:28 0
pENTR1A-HA-Jag1
 
Resource Report
Resource Website
RRID:Addgene_46052 Jag1 Rattus norvegicus Kanamycin PMID:23419361 Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:15:28 0
EGFP-Myo1b motor
 
Resource Report
Resource Website
RRID:Addgene_187364 myosin 1b isoform b motor domain Rattus norvegicus Kanamycin PMID:26195670 PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT Backbone Marker:Clontech; Backbone Size:4694; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:36 0
Syt2
 
Resource Report
Resource Website
RRID:Addgene_186688 Synaptotagmin 2 Rattus norvegicus Ampicillin PMID:35322233 Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:54 0
pGP-CMV-GCaMP3-44
 
Resource Report
Resource Website
RRID:Addgene_91780 GCaMP3-44 Rattus norvegicus Kanamycin PMID:28162809 Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:24 0
pGP-CMV-GCaMP6-210
 
Resource Report
Resource Website
RRID:Addgene_91778 GCaMP6-210 Rattus norvegicus Kanamycin PMID:28162809 Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:23 0
pZac2.1 GfaABC1D rM3D mCherry SV40
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_92285 rM3D Rattus norvegicus Ampicillin PMID:28712653 Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:22:29 2
FKBP-Stx4-mCitrine
 
Resource Report
Resource Website
RRID:Addgene_92427 Stx4 Rattus norvegicus Kanamycin PMID:28524818 Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:30 0
FKBP-Stx3-mCitrine
 
Resource Report
Resource Website
RRID:Addgene_92428 Stx3 Rattus norvegicus Kanamycin PMID:28524818 Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:30 0
Stx3-pmCitrine
 
Resource Report
Resource Website
RRID:Addgene_92421 Stx3 Rattus norvegicus Kanamycin PMID:28524818 Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:30 0
Stx4-pmCitrine
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_92422 Stx4 Rattus norvegicus Kanamycin PMID:28524818 Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:30 1
pcDNA3_mScarlet-LAMP1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_185138 Lysosome-associated membrane glycoprotein 1 Rattus norvegicus Ampicillin Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing. This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342 Backbone Marker:Thermo Fisher Scientific; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-21 of LAMP1 2026-08-15 01:23:18 2
pLenti sfGFP-LAMP1-mCherry (pHLARE)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_164478 LAMP1 Rattus norvegicus Ampicillin PMID:33237838 Please note there is a single mutation in sfGFP-D117Y. Depositor confirms this is not a concern for plasmid function. Backbone Size:6900; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:23:22 2
pLAMP1-miRFP670nano3
 
Resource Report
Resource Website
RRID:Addgene_184669 LAMP1-miRFP670nano3 Rattus norvegicus Kanamycin PMID:35606446 Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:22 0
FKBP-AP180-GFP
 
Resource Report
Resource Website
RRID:Addgene_186577 AP180 Rattus norvegicus Kanamycin PMID:35852853 Please note: The plasmid is difficult to sequence near bases 2140-2220 that are within the insert. Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:27 0
pGEX-4T Doc2beta C2AB(125) WT
 
Resource Report
Resource Website
RRID:Addgene_134690 Double C2 protein beta Rattus norvegicus Ampicillin PMID:31147445 Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:08 0
pGEX-4T Doc2beta C2AB(125) H158C
 
Resource Report
Resource Website
RRID:Addgene_134691 Double C2 protein beta Rattus norvegicus Ampicillin PMID:31147445 Backbone Marker:GE Healthcare; Vector Backbone:pGEX4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin H158C, C145A, C217A, C249A, C290A, C338A, C387A 2026-08-15 01:23:08 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.