Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33327 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34686 Copy
Species: Rattus norvegicus
Genetic Insert: dynamin 2
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_34687 Copy
Species: Rattus norvegicus
Genetic Insert: βarrestin2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15699045
Proper citation: RRID:Addgene_35412 Copy
Species: Rattus norvegicus
Genetic Insert: VGAT
Vector Backbone Description: Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37812725
Comments: Please visit https://doi.org/10.1101/2023.08.07.552338 for bioRxiv preprint.
Proper citation: RRID:Addgene_207467 Copy
Species: Rattus norvegicus
Genetic Insert: VGLUT2
Vector Backbone Description: Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31003725
Proper citation: RRID:Addgene_207469 Copy
Species: Rattus norvegicus
Genetic Insert: VGLUT1
Vector Backbone Description: Vector Backbone:pJHUMCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_207470 Copy
Species: Rattus norvegicus
Genetic Insert: 3HA-EGFP-miniTurboID-OMP25
Vector Backbone Description: Backbone Size:9000; Vector Backbone:s1300-3XFLAG; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38261530
Proper citation: RRID:Addgene_223331 Copy
Species: Rattus norvegicus
Genetic Insert: 3HA-miniTurboID-EGFP-OMP25
Vector Backbone Description: Backbone Size:9000; Vector Backbone:s1300-EGFP; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38261530
Proper citation: RRID:Addgene_223332 Copy
Species: Rattus norvegicus
Genetic Insert: CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG)
Vector Backbone Description: Backbone Marker:Dr Konstantin Kogan; Backbone Size:14900; Vector Backbone:pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37226896
Proper citation: RRID:Addgene_202555 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:7450; Vector Backbone:pCIG2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38728007
Proper citation: RRID:Addgene_219441 Copy
Species: Rattus norvegicus
Genetic Insert: LC3B
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6020; Vector Backbone:pHTN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38728007
Proper citation: RRID:Addgene_219440 Copy
Species: Rattus norvegicus
Genetic Insert: mVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(wt)-mEGFP(A206K)
Vector Backbone Description: Backbone Size:4758; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39385027
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.08.01.549180v1.full.pdf for bioRxiv preprint.
Proper citation: RRID:Addgene_220366 Copy
Species: Rattus norvegicus
Genetic Insert: macroH2A1.2-F192V
Vector Backbone Description: Backbone Marker:Addgene #223708; Backbone Size:4733; Vector Backbone:macroH2A.2-GFP(pc 2189); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39189450
Proper citation: RRID:Addgene_223438 Copy
Species: Rattus norvegicus
Genetic Insert: macroH2A1.1-F192V
Vector Backbone Description: Backbone Marker:Addgene #223707; Backbone Size:4733; Vector Backbone:macroH2A.1-GFP(pc 2188); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39189450
Proper citation: RRID:Addgene_223437 Copy
Species: Rattus norvegicus
Genetic Insert: macroH2A1.1-GFP
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39189450
Proper citation: RRID:Addgene_223707 Copy
Species: Rattus norvegicus
Genetic Insert: APOBEC1
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39152130
Proper citation: RRID:Addgene_226012 Copy
Species: Rattus norvegicus
Genetic Insert: EF-1a polyA
Vector Backbone Description: Vector Backbone:pDONR P2R P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41230856
Comments: Please visit https://doi.org/10.1101/2024.07.13.603267 for bioRxiv preprint.
Proper citation: RRID:Addgene_224526 Copy
Species: Rattus norvegicus
Genetic Insert: mGold2t-Lysosome-N-20
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40185748
Proper citation: RRID:Addgene_231778 Copy
Species: Rattus norvegicus
Genetic Insert: mGold2s-Lysosome-N-20
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40185748
Proper citation: RRID:Addgene_231770 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
