Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPB-CAG-empty-pgk-hph Resource Report Resource Website 1+ mentions |
RRID:Addgene_48753 | Ampicillin | PMID:23582324 | Plasmid map is theoretical and may not represent actual sequence. The presence of important plasmid features have been verified by sequencing. | Vector Backbone:Bluescript; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 4 | |||
|
pPy-CAG-GFP-IRES-Pac Resource Report Resource Website 1+ mentions |
RRID:Addgene_48759 | EGFP | Synthetic | Ampicillin | PMID:23582324 | Backbone Size:6600; Vector Backbone:Bluescript; Vector Types:Mammalian Expression, pPy; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 1 | ||
|
pGL3 Resource Report Resource Website 10+ mentions |
RRID:Addgene_48743 | truncated mPer2 promoter/enhancer region (-1128 to +1060) | Mus musculus | Ampicillin | PMID:15699353 | Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | truncated promoter region (see pGL6) | 2026-08-15 01:15:53 | 17 |
|
pGL2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48742 | truncated mPer2 promoter/enhancer region (-1128 to +386) | Mus musculus | Ampicillin | PMID:15699353 | Minor sequencing discrepancies may exist between the mPer2 promoter reference sequence and Addgene's sequencing results, but do not affect the function of the plasmid. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | truncated promoter region (see pGL6) | 2026-08-15 01:15:53 | 1 |
|
p8RwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48733 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:17603495 | This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 2 | |
|
pRwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48734 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:19073722 | Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 1 | |
|
pFRT-TODestFLAGHAhFMRPiso1I304N Resource Report Resource Website 1+ mentions |
RRID:Addgene_48692 | FlagHA FMR1 Iso 1 I304N | Homo sapiens | Ampicillin | PMID:23235829 | Backbone Marker:Life Technologies, Modified by Tuschl Lab; Backbone Size:5322; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 3 | ||
|
pUltra-Chili-Luc Resource Report Resource Website 10+ mentions |
RRID:Addgene_48688 | Ampicillin | PMID:34088832 | See Addgene plasmid #24129 for cloning details. | Backbone Marker:Malcolm Moore lab; Vector Backbone:pUltra-Chili; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 33 | |||
|
pUltra-Chili Resource Report Resource Website 10+ mentions |
RRID:Addgene_48687 | Ampicillin | See Addgene plasmid #24129 for cloning details. | Backbone Marker:Malcolm Moore lab; Backbone Size:8300; Vector Backbone:pUltra; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 19 | ||||
|
Nanog-2A-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_48680 | Nanog | Mus musculus | Ampicillin | PMID:23992847 | Vector Backbone:pCR2.1TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 1 | ||
|
M-tdTom-SP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 2 | ||
|
pcDNA3.1-Myc-14-3-3ζ Resource Report Resource Website 1+ mentions |
RRID:Addgene_48798 | YWHAZ | Homo sapiens | Ampicillin | PMID:12757707 | Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 2 | ||
|
M-NMn-VP64 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48676 | Cas9-VP64, nuclease-null | N. meningitidis | Ampicillin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | nuclease-null | 2026-08-15 01:15:52 | 5 | |
|
pcDNA3.1-HA-14-3-3 ϵ Resource Report Resource Website 1+ mentions |
RRID:Addgene_48797 | YWHAE 14-3-3 ϵ | Homo sapiens | Ampicillin | PMID:12757707 | Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:54 | 2 | ||
|
M-NMcas Resource Report Resource Website 1+ mentions |
RRID:Addgene_48670 | Cas9 | N. meningitidis | Ampicillin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 hygro; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:52 | 2 | ||
|
M-SPn-VP64 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48674 | Cas9-VP64, nuclease-null | S. pyogenes | Ampicillin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | nuclease-null | 2026-08-15 01:15:53 | 6 | |
|
M-ST1-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_48672 | sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter | Synthetic | Kanamycin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:52 | 4 | ||
|
CBIG-RORb Resource Report Resource Website 1+ mentions |
RRID:Addgene_48709 | RORb | Mus musculus | Ampicillin | Please note that Addgene's sequencing results identified a few differences in the vector backbone when compared to the full plasmid sequence from the depositing laboratory. According to the depositor, these differences are not a concern for the function of the plasmid. | Vector Backbone:CBIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 1 | ||
|
M-ST1cas Resource Report Resource Website 1+ mentions |
RRID:Addgene_48669 | Cas9 | S. thermophilus #1 | Ampicillin | PMID:24076762 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3 TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:52 | 7 | ||
|
8xLexA-binding elements/pMD20 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48807 | 8xLexA-binding elements | Synthetic | Ampicillin | PMID:22043306 | Backbone Marker:Takara Bio; Backbone Size:2736; Vector Backbone:pMD20; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:53 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
