Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013198
Proper citation: RRID:Addgene_49042 Copy
Genetic Insert: aminoglycoside 3' phosphotransferase
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48993 Copy
Species: Bos taurus
Genetic Insert: Enteropeptidase, peptidase domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24184090
Proper citation: RRID:Addgene_49048 Copy
Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_49046 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors:
http://www.addgene.org/48240/
http://www.addgene.org/48239/
http://www.addgene.org/48238/
http://www.addgene.org/48236/
For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_49045 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6578; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.
Proper citation: RRID:Addgene_49031 Copy
Vector Backbone Description: Backbone Marker:Malcolm Moore lab; Vector Backbone:pUltra; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: AmCyan1 excitation and emission maxima are 458 and 489 nm, respectively
Proper citation: RRID:Addgene_48974 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8362; Vector Backbone:pYES2/CT; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.
The ampicillin resistance cassette is located at bp# 4361-5221.
Proper citation: RRID:Addgene_49027 Copy
Species: Homo sapiens
Genetic Insert: SUMO3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21247896
Proper citation: RRID:Addgene_48964 Copy
Species: Homo sapiens
Genetic Insert: SUMO3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21247896
Proper citation: RRID:Addgene_48963 Copy
Species: E. coli
Genetic Insert: Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated
Vector Backbone Description: Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24136966
Comments: E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA
This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin.
The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1).
Proper citation: RRID:Addgene_49018 Copy
Vector Backbone Description: Backbone Marker:life technologies; Vector Backbone:pMA-T; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013562
Proper citation: RRID:Addgene_48961 Copy
Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21247896
Comments: Please note this plasmid contains the mature form of SUMO1, which lacks the last 4 amino acids from the C-terminus.
Proper citation: RRID:Addgene_48966 Copy
Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21247896
Proper citation: RRID:Addgene_48965 Copy
Genetic Insert: cas9
Vector Backbone Description: Backbone Marker:life technologies; Backbone Size:4959; Vector Backbone:pDEST; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013562
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_48960 Copy
Species: Homo sapiens
Genetic Insert: dCas9_VP64 (human-codon-optimized)
Vector Backbone Description: Backbone Marker:Evrogen; Backbone Size:4000; Vector Backbone:phi-Yellow-Dest; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23977949
Comments: L591M mutation with dCas9
Proper citation: RRID:Addgene_49015 Copy
Genetic Insert: Multiple Cloning Site
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2RP3; Vector Types:gateway 3' Entry; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24036310
Comments: There is a single base mismatch between Addgene's quality control sequence and the full plasmid reference sequence. The change is in backbone region and should not affect function.
Proper citation: RRID:Addgene_49004 Copy
Species: Homo sapiens
Genetic Insert: Malic Enzyme 1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23334421
Proper citation: RRID:Addgene_49163 Copy
Species: Homo sapiens
Genetic Insert: Sec61 beta
Vector Backbone Description: Backbone Marker:Evrogen; Backbone Size:4707; Vector Backbone:pTagBFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20955502
Proper citation: RRID:Addgene_49154 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mitochondrial targeting signal
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21885730
Proper citation: RRID:Addgene_49151 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
