Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDONOR223 RpH-LAMP1-3xFLAG Resource Report Resource Website |
RRID:Addgene_163019 | RpH-LAMP1-3xFLAG | Mus musculus | Spectinomycin | PMID:32515674 | Vector Backbone:pDONOR223; Vector Types:GATEWAY system; Bacterial Resistance:Spectinomycin | 2026-08-15 01:09:07 | 0 | ||
|
pcDNA-Fah_W Resource Report Resource Website |
RRID:Addgene_163087 | Fah_W | Mus musculus | Ampicillin | PMID:31611405 | Backbone Marker:invitrogen; Backbone Size:5506; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:08 | 0 | ||
|
pcDNA-Fah_S Resource Report Resource Website |
RRID:Addgene_163086 | Fah_S | Mus musculus | Ampicillin | PMID:31611405 | Backbone Marker:invitrogen; Backbone Size:5506; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:08 | 0 | ||
|
pGST-Fah_S Resource Report Resource Website |
RRID:Addgene_163088 | Fah_S | Mus musculus | Ampicillin | PMID:31611405 | Backbone Marker:invitrogen; Backbone Size:5042; Vector Backbone:PGST parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:08 | 0 | ||
|
I-2/pCS2MT Resource Report Resource Website 1+ mentions |
RRID:Addgene_16317 | Inhibitor-2 | Mus musculus | Ampicillin | PMID:12796505 | For sense transcripts, cut with NotI and transcribe with SP6 | Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Vertebrate expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:09 | 1 | |
|
5.2 kB VEGF-luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_27987 | 5.2 kB VEGF | Mus musculus | Ampicillin | PMID:15582599 | Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:08 | 1 | ||
|
IL6-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_28088 | IL6 | Mus musculus | Kanamycin | PMID:17606866 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:09 | 5 | ||
|
SF-1 shRNA #3 Resource Report Resource Website |
RRID:Addgene_28188 | Nr5a1 shRNA | Mus musculus | Ampicillin | PMID:18388192 | shRNA #3 sequence: GATCCTCAATGAGAAGGTTGTTGCGGTTGATATCCGCCGCAACAACCTTCTCATTGACGC | Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:12 | 0 | |
|
p-1459-adcy4-Luc Resource Report Resource Website |
RRID:Addgene_28184 | Adcy4 promoter | Mus musculus | Ampicillin | PMID:12239114 | Contains a total of ~1812 bp of genomic DNA--i.e.,1459 bp upstream of the Adcy4 transcription start site and 353 bp downstream of the transcription start site. The downstream DNA includes exon I, intron I and the non-coding portion of exon II. | Backbone Marker:Promega; Backbone Size:5000; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:10 | 0 | |
|
R-G324D-(Kin-8) Resource Report Resource Website 1+ mentions |
RRID:Addgene_28179 | Prkar1a | Mus musculus | Ampicillin | PMID:8388994 | Expression vector encoding dominant-negative regulatory subunit of type 1 cAMP-dependent protein kinase. pMT-REV is a zinc-inducible expression vector driven by the metallothionein promoter. | Backbone Size:7600; Vector Backbone:pMT-REV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | G324D | 2026-08-15 01:13:11 | 1 |
|
pEB-C5 Resource Report Resource Website 10+ mentions |
RRID:Addgene_28213 | Oct4, Sox2, Klf4, c-Myc, Lin28 | Mus musculus | Ampicillin | PMID:21243013 | Please note that Addgene's sequencing results using the CMV-F and pCEP-F primers found 2 sequence variants within and after the CMV enhancer. One is a C->G mismatch at position 775 within the CMV enhancer and the second is a deletion at position 949 just after the end of the CAG enhancer, as compared to the full plasmid sequence provided by the depositing scientist. The significance of the two sequence variants is unclear; however, the plasmid functions as described in the associated publication. Addgene's other 4 sequencing results completely matched the depositor's sequence. | Backbone Marker:invitrogen; Backbone Size:10200; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:11 | 10 | |
|
pCMV-NHERF1-EB Resource Report Resource Website 1+ mentions |
RRID:Addgene_28297 | NHERF1 | Mus musculus | Ampicillin | PMID:17242191 | Backbone Size:5000; Vector Backbone:pCMV-2-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains only the EB domain aa 262-355 (deletion of the PDZ1 and PDZ2) | 2026-08-15 01:13:13 | 2 | |
|
DCX 3UTRhp Resource Report Resource Website |
RRID:Addgene_28301 | Doublecortin 3' Untranslated region | Mus musculus | Ampicillin | PMID:14625554 | DCX 3’UTR hairpin siRNA sequence: 5’-GCUCAAGUGACCAACAAGGCUAUAGACACAAUAGCCUUGUUGGUCACUUGAGC-3’ | Backbone Marker:University of Michigan; Backbone Size:4143; Vector Backbone:mU6pro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:13 | 0 | |
|
DCX 3UTRm3hp Resource Report Resource Website |
RRID:Addgene_28302 | Doublecortin 3' Untranslated region mutated | Mus musculus | Ampicillin | PMID:14625554 | DCX 3’UTRm3 mutation hairpin siRNA sequence: 5’-GCUCAAGUCACGAAGAAGGCUAUAGACACAAUAGCCUUCUUCGUGACUUGAGC-3’ | Backbone Marker:University of Michigan; Backbone Size:4143; Vector Backbone:mU6pro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 3 base pair mutation in DCX 3'UTR region | 2026-08-15 01:13:12 | 0 |
|
pEF-HA-Net1 Resource Report Resource Website |
RRID:Addgene_28264 | Net1 | Mus musculus | Ampicillin | PMID:19586902 | Backbone Size:6000; Vector Backbone:pEF-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:12 | 0 | ||
|
pGEX-KG/Net1 Resource Report Resource Website |
RRID:Addgene_28260 | Net1 | Mus musculus | Ampicillin | PMID:19586902 | Contains wt mNet1 (aa 1-595) | Backbone Marker:Amersham; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:11 | 0 | |
|
pUb6-Zpo1-V5/His Resource Report Resource Website |
RRID:Addgene_29323 | Zeppo1 | Mus musculus | Ampicillin | PMID:21317240 | Backbone Marker:Invitrogen; Backbone Size:5422; Vector Backbone:pUB6/V5-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:16 | 0 | ||
|
pRK5-mouse-DJ1-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_29396 | DJ1 | Mus musculus | Ampicillin | PMID:15663963 | Backbone Size:4756; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:19 | 6 | ||
|
Venus Cam KII alpha mutant T286D Resource Report Resource Website 1+ mentions |
RRID:Addgene_29429 | Venus CAM KII Alpha | Mus musculus | Kanamycin | PMID:19339497 | Backbone Size:3984; Vector Backbone:pEGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T286D mutation in CamKIIa sequence | 2026-08-15 01:13:17 | 1 | |
|
CamKII alpha Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_29427 | Venus CamKII alpha | Mus musculus | Kanamycin | PMID:19339497 | Backbone Size:3984; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:19 | 5 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
