Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Lucigen; Backbone Size:1788; Vector Backbone:pSmart-Kan-HC; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: Use enzyme BbsI for cloning in the sgRNA
Proper citation: RRID:Addgene_49157 Copy
Species: Homo sapiens
Genetic Insert: Sec61 beta
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pAcGFP1-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20955502
Comments: *Note that the AcGFP1 is still present in this plasmid, but it is not expressed.
Proper citation: RRID:Addgene_49155 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple155-emGFP-WPRE
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531684
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Additional References:
1 Korecki, A. J. et al. Twenty-Seven Tamoxifen-Inducible iCre-Driver Mouse Strains for Eye and Brain, Including Seventeen Carrying a New Inducible-First Constitutive-Ready Allele. Genetics 211, 1155-1177 (2019).
2 de Leeuw, C. N. et al. rAAV-Compatible MiniPromoters for Restricted Expression in the Brain and Eye. Molecular Brain 9, 52 (2016).
3 Scalabrino, M. L. et al. Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol Genet 24, 6229-6239, doi:10.1093/hmg/ddv341, ddv341 [pii] (2015).
4 de Leeuw, C. N. et al. Targeted CNS delivery using human MiniPromoters and demonstrated compatibility with adeno-associated viral vectors. Mol Ther Methods Clin Dev 1, 1-15 (2014).
Proper citation: RRID:Addgene_49140 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple67-emGFP-WPRE
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30765420
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Proper citation: RRID:Addgene_49138 Copy
Species: M. barkeri
Genetic Insert: tRNA synthetase
Vector Backbone Description: Backbone Size:6290; Vector Backbone:pDule; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21678540
Proper citation: RRID:Addgene_49086 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24339991
Comments: Synthetic cDNA encoding full length human NKCC1, with 29 silent restriction sites in NKCC1 coding region
This plasmid has also been described in Monette et al., J Biol Chem. 2014 Jan 22 (https://www.ncbi.nlm.nih.gov/pubmed/24451383)
Proper citation: RRID:Addgene_49085 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple94-iCre
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30062914
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Proper citation: RRID:Addgene_49125 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple304-iCre
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30062914
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Proper citation: RRID:Addgene_49123 Copy
Species: Synthetic
Genetic Insert: PercevalHR
Vector Backbone Description: Backbone Size:9222; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096541
Proper citation: RRID:Addgene_49083 Copy
Species: Synthetic
Genetic Insert: PercevalHR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2327; Vector Backbone:pRsetB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096541
Proper citation: RRID:Addgene_49081 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple155-iCre
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531684
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Additional References:
1 Korecki, A. J. et al. Twenty-Seven Tamoxifen-Inducible iCre-Driver Mouse Strains for Eye and Brain, Including Seventeen Carrying a New Inducible-First Constitutive-Ready Allele. Genetics 211, 1155-1177 (2019).
2 de Leeuw, C. N. et al. rAAV-Compatible MiniPromoters for Restricted Expression in the Brain and Eye. Molecular Brain 9, 52 (2016).
3 Scalabrino, M. L. et al. Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol Genet 24, 6229-6239, doi:10.1093/hmg/ddv341, ddv341 [pii] (2015).
4 de Leeuw, C. N. et al. Targeted CNS delivery using human MiniPromoters and demonstrated compatibility with adeno-associated viral vectors. Mol Ther Methods Clin Dev 1, 1-15 (2014).
Proper citation: RRID:Addgene_49116 Copy
Species: Synthetic
Genetic Insert: ssAAV-Ple261-iCre
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31323276
Comments: Please see the annotated GenBank file and the additional image file for the specific location of the minipromoter in this plasmid.
Please see the following publication for more information:
rAAV-compatible MiniPromoters for restricted expression in the brain and eye.
de Leeuw et al. Mol Brain. 2016 May 10;9(1):52. doi: 10.1186/s13041-016-0232-4. PMID 27164903
Proper citation: RRID:Addgene_49113 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24339991
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_49063 Copy
Species: rabies virus
Genetic Insert: Cerulean-E2A-RG
Vector Backbone Description: Backbone Marker:Callaway Addgene 26197; Vector Backbone:pAAV-EF1a-FLEX-GTB; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean.
Proper citation: RRID:Addgene_49101 Copy
Species: Aequorea victoria green
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:6204; Vector Backbone:adeno-associated viral (AAVsp); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11842206
Comments: Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs).
Proper citation: RRID:Addgene_49055 Copy
Species: Homo sapiens
Genetic Insert: EDD
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4373; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12011095
Comments: Addgene NGS results identified a K503R mutation within the UBR5 translation. There is no information on the functional consequence of this mutation
Proper citation: RRID:Addgene_37188 Copy
Vector Backbone Description: Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37183 Copy
Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747757
Comments: For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar
Proper citation: RRID:Addgene_37184 Copy
Species: Homo sapiens
Genetic Insert: EDD
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4708; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12011095
Proper citation: RRID:Addgene_37190 Copy
Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.
Proper citation: RRID:Addgene_37215 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
