Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
D28 Cortactin GFP Resource Report Resource Website |
RRID:Addgene_26723 | Cortactin | Mus musculus | Kanamycin | PMID:16280362 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Deletion removed 28 amino acids (aa# 334-361) encompassing the four calpain cleavage sites. All four sites are located immediately following the last half repeat of the actin binding domain and before the {alpha}-helical domain. | 2026-08-15 01:12:56 | 0 | |
|
GFP-rGBD Resource Report Resource Website 10+ mentions |
RRID:Addgene_26732 | rhotekin | Mus musculus | Ampicillin | PMID:15684032 | The RhoA-binding domain of rhotekin (rGBD) was fused to eGFP in order to visualize active RhoA | Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rho; Bacterial Resistance:Ampicillin | RhoA binding domain of rhotekin | 2026-08-15 01:12:56 | 13 |
|
pEGFPc2 mAbp1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26719 | Actin-binding Protein-1 | Mus musculus | Kanamycin | PMID:19910490 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:55 | 2 | ||
|
pLv-CMV-MyoD-ER(T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_26809 | MyoD-ER(T) | Mus musculus | Ampicillin | PMID:18511457 | Cloning of the MyoD-ER(T): Briefly, the full-length mouse MyoD cDNA was isolated and cloned from a previously described adenoviral vector (Lattanzi et al., 1998). A cDNA for the modified estrogen receptor responsive to tamoxifen and 4-hydroxytamoxifen, ER(T) (Danielian et al., 1993), was cloned using a PCR method with the primer pair including an internal ClaI restriction enzyme site: (sense) 5′-ACGGCATCGATTCTGCTGGAGACATGAGAGCT-3′, and (anti-sense) 5′-GCGCCATCGATGACTGTGGCAGGGAAACCCT-3′, and then inserted into the NarI site (amino acid 173) in the middle of the mouse MyoD cDNA. The final clone was verified by DNA sequencing. There is a mutation G525R in the mouse estrogen receptor; the mutation confers selective 4-hydroxytamoxifen sensitivity (vs. estradiol) (Danielian et al. 1993 Molec Endocrin 7: 232-240). | Backbone Size:6707; Vector Backbone:pRRL-cPPT-X-PRE-SIN; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:56 | 3 | |
|
pLv-CMV-MyoD Resource Report Resource Website 1+ mentions |
RRID:Addgene_26808 | MyoD | Mus musculus | Ampicillin | PMID:18511457 | CMV promotor | Backbone Marker:Lentiviral plasmid backbone from L. Naldini; Backbone Size:6707; Vector Backbone:pRRL-cPPT-X-PRE-SIN; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:56 | 2 | |
|
pBABEpuro WT ATG3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26926 | autophagy-related 3 (yeast) | Mus musculus | Ampicillin | PMID:20723759 | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:57 | 1 | ||
|
pCAGGS-NICD Resource Report Resource Website 10+ mentions |
RRID:Addgene_26891 | NICD | Mus musculus | Ampicillin | PMID:16508304 | Backbone Size:4800; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E2299K | 2026-08-15 01:12:57 | 16 | |
|
pHes5p-luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_26869 | Hes5 promoter | Mus musculus | Ampicillin | PMID:17721509 | Contains the Hes5 promoter (-685 to +28). C->T mutation in the center of the promoter does affect function. | Backbone Marker:Promega; Backbone Size:0; Vector Backbone:PGV-B; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:57 | 3 | |
|
Hes5p-DsRed Resource Report Resource Website 1+ mentions |
RRID:Addgene_26868 | Hes5 promoter | Mus musculus | Ampicillin | PMID:17721509 | Hes5p from -685 to +28. | Backbone Marker:Clontech; Backbone Size:4200; Vector Backbone:pDsRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:57 | 4 | |
|
MIG(F)-CRel Resource Report Resource Website 1+ mentions |
RRID:Addgene_26984 | CRel | Mus musculus | Ampicillin | PMID:16166378 | Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:58 | 1 | ||
|
MIG(F)-RelA Resource Report Resource Website |
RRID:Addgene_26986 | RelA | Mus musculus | Ampicillin | PMID:16166378 | Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:58 | 0 | ||
|
pMSCV FHA-Stop Resource Report Resource Website 1+ mentions |
RRID:Addgene_27050 | autophagy-related 12 (yeast) | Mus musculus | Ampicillin | PMID:20723759 | Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed glycine 141 to stop codon. | 2026-08-15 01:12:59 | 1 | |
|
p3xFLAG-CMV-Tlr4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27148 | toll-like receptor 4 | Mus musculus | Ampicillin | PMID:9851930 | Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Native signal peptide sequence (original amino acids 1-24) was removed for cloning. | 2026-08-15 01:13:00 | 1 | |
|
p3xFLAG-CMV-Tlr4(Lps) Resource Report Resource Website |
RRID:Addgene_27149 | toll-like receptor 4(Lps) | Mus musculus | Ampicillin | PMID:9851930 | Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Proline 712 to Histidine. Native signal peptide sequence (original amino acids 1-24) was removed for cloning. | 2026-08-15 01:13:00 | 0 | |
|
pRK5-Flag-HA-Merlin Resource Report Resource Website 1+ mentions |
RRID:Addgene_27104 | Merlin | Mus musculus | Ampicillin | PMID:20178741 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 1 | ||
|
pRK5-Merlin-Flag-HA Resource Report Resource Website |
RRID:Addgene_27103 | Merlin | Mus musculus | Ampicillin | PMID:20178741 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:59 | 0 | ||
|
pLKO.1-MKL1/2 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27161 | shRNA MKL1+2 | Mus musculus | Ampicillin | PMID:20466732 | shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA | Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:00 | 5 | |
|
pcDNA-FLAG-Mo-Trip6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27254 | Trip6 | Mus musculus | Ampicillin | PMID:10395914 | Trip6 cDNA starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 1 | |
|
pAMPK alpha1 full length Resource Report Resource Website 1+ mentions |
RRID:Addgene_27297 | AMPK alpha1 | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 4 | |||
|
pcDNA3/mPax3-3xHA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27319 | Pax3 | Mus musculus | Ampicillin | PMID:7744814 | Backbone Size:5600; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:01 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
