Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Cortactin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16280362
Proper citation: RRID:Addgene_26723 Copy
Species: Mus musculus
Genetic Insert: rhotekin
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rho; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15684032
Comments: The RhoA-binding domain of rhotekin (rGBD) was fused to eGFP in order to visualize active RhoA
Proper citation: RRID:Addgene_26732 Copy
Species: Mus musculus
Genetic Insert: Actin-binding Protein-1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19910490
Proper citation: RRID:Addgene_26719 Copy
Species: Mus musculus
Genetic Insert: MyoD-ER(T)
Vector Backbone Description: Backbone Size:6707; Vector Backbone:pRRL-cPPT-X-PRE-SIN; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18511457
Comments: Cloning of the MyoD-ER(T):
Briefly, the full-length mouse MyoD cDNA was isolated and cloned from a previously described adenoviral vector (Lattanzi et al., 1998). A cDNA for the modified estrogen receptor responsive to tamoxifen and 4-hydroxytamoxifen, ER(T) (Danielian et al., 1993), was cloned using a PCR method with the primer pair including an internal ClaI restriction enzyme site: (sense) 5′-ACGGCATCGATTCTGCTGGAGACATGAGAGCT-3′, and (anti-sense) 5′-GCGCCATCGATGACTGTGGCAGGGAAACCCT-3′, and then inserted into the NarI site (amino acid 173) in the middle of the mouse MyoD cDNA. The final clone was verified by DNA sequencing.
There is a mutation G525R in the mouse estrogen receptor; the mutation confers selective 4-hydroxytamoxifen sensitivity (vs. estradiol) (Danielian et al. 1993 Molec Endocrin 7: 232-240).
Proper citation: RRID:Addgene_26809 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Marker:Lentiviral plasmid backbone from L. Naldini; Backbone Size:6707; Vector Backbone:pRRL-cPPT-X-PRE-SIN; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18511457
Comments: CMV promotor
Proper citation: RRID:Addgene_26808 Copy
Species: Mus musculus
Genetic Insert: autophagy-related 3 (yeast)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759
Proper citation: RRID:Addgene_26926 Copy
Species: Mus musculus
Genetic Insert: NICD
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16508304
Proper citation: RRID:Addgene_26891 Copy
Species: Mus musculus
Genetic Insert: Hes5 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:0; Vector Backbone:PGV-B; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17721509
Comments: Contains the Hes5 promoter (-685 to +28).
C->T mutation in the center of the promoter does affect function.
Proper citation: RRID:Addgene_26869 Copy
Species: Mus musculus
Genetic Insert: Hes5 promoter
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4200; Vector Backbone:pDsRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17721509
Comments: Hes5p from -685 to +28.
Proper citation: RRID:Addgene_26868 Copy
Species: Mus musculus
Genetic Insert: CRel
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16166378
Proper citation: RRID:Addgene_26984 Copy
Species: Mus musculus
Genetic Insert: RelA
Vector Backbone Description: Backbone Size:6500; Vector Backbone:pMIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16166378
Proper citation: RRID:Addgene_26986 Copy
Species: Mus musculus
Genetic Insert: autophagy-related 12 (yeast)
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759
Proper citation: RRID:Addgene_27050 Copy
Species: Mus musculus
Genetic Insert: toll-like receptor 4
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9851930
Proper citation: RRID:Addgene_27148 Copy
Species: Mus musculus
Genetic Insert: toll-like receptor 4(Lps)
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4732; Vector Backbone:p3xFLAG-CMV-8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9851930
Proper citation: RRID:Addgene_27149 Copy
Species: Mus musculus
Genetic Insert: Merlin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20178741
Proper citation: RRID:Addgene_27104 Copy
Species: Mus musculus
Genetic Insert: Merlin
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20178741
Proper citation: RRID:Addgene_27103 Copy
Species: Mus musculus
Genetic Insert: shRNA MKL1+2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Comments: shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA
Proper citation: RRID:Addgene_27161 Copy
Species: Mus musculus
Genetic Insert: Trip6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10395914
Comments: Trip6 cDNA starts at aa 2.
Proper citation: RRID:Addgene_27254 Copy
Species: Mus musculus
Genetic Insert: AMPK alpha1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27297 Copy
Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7744814
Proper citation: RRID:Addgene_27319 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
