Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pSICO-Flpo Resource Report Resource Website 1+ mentions |
RRID:Addgene_24969 | Flp recombinase | Ampicillin | PMID:20479239 | pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression. The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website http://web.mit.edu/ccr/labs/jacks/protocols/pSico.html | Backbone Marker:Addgene Plasmid 11578; Backbone Size:6739; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 3 | ||
|
pCS2 xBtg-X Resource Report Resource Website |
RRID:Addgene_24964 | Btg-X | Xenopus laevis | Ampicillin | PMID:15879552 | For sense mRNA cut with NotI, transcribe with SP6 For antisense cut with ClaI, transcribe with T7 | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:58 | 0 | |
|
pCS2 xLabial Resource Report Resource Website |
RRID:Addgene_24965 | labial | Xenopus laevis | Ampicillin | PMID:1677215 | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:58 | 0 | ||
|
pKW08-Lx-Int Resource Report Resource Website 1+ mentions |
RRID:Addgene_25015 | pKW08-Lx-Int | Hygromycin | PMID:20434484 | Backbone Size:8535; Vector Backbone:pMC1M; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | Addgene | 2026-10-31 02:07:59 | 2 | |||
|
pCS2 Antivin Resource Report Resource Website |
RRID:Addgene_24961 | Antivin | Xenopus laevis | Ampicillin | PMID:16172975 | For antisense cut with HindIII, transcribe with T7 For sense cut with NotI, transcribe with SP6 | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:58 | 0 | |
|
pMEND-Lx Resource Report Resource Website 1+ mentions |
RRID:Addgene_25010 | pMEND-Lx | Kanamycin | PMID:20434484 | Backbone Size:8798; Vector Backbone:pMINDLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-31 02:07:59 | 1 | |||
|
pMIND-Lx Resource Report Resource Website |
RRID:Addgene_25013 | pMIND-Lx | Kanamycin | PMID:20434484 | Backbone Size:8798; Vector Backbone:pSHKLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-31 02:07:59 | 0 | |||
|
pCS2 xFrzb-HA Resource Report Resource Website |
RRID:Addgene_24979 | Frzb-1 HA | Xenopus laevis | Ampicillin | PMID:9118218 | For sense, cut with NotI, transcribe with SP6. HA tag is cloned between Ser158 and Met159 of Frezzled by PCR. HA tag includes a AatII diagnostic site. | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | |
|
pBS xChordin Resource Report Resource Website |
RRID:Addgene_24975 | Chordin | Xenopus laevis | Ampicillin | PMID:8001117 | Partial 2.8 kB clone of the original Xenopus chordin cDNA lacking 3' portion. For antisense cut with EcoRI, transcribe with T7 For Northern blot probe, cut with EcoRI and XhoI | Backbone Size:3000; Vector Backbone:pBS-SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | |
|
pCS2 xenopus twisted gastrulation Resource Report Resource Website |
RRID:Addgene_24974 | twisted gastrulation | Mus musculus | Ampicillin | PMID:11714670 | mRNA injection sense: cut with NotI, transcribe with SP6 Contains the Xenopus Chordin signal peptide and the N terminus until Ala41, followed by a Flag tag sequence. | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | |
|
pAc5.1B-EGFP-DmHPat Resource Report Resource Website |
RRID:Addgene_25029 | HPat | Drosophila melanogaster | Ampicillin | PMID:20404111 | Backbone Marker:Elisa Izaurralde; Backbone Size:6080; Vector Backbone:pAc5.1B-EGFP; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | ||
|
CMV-miR-31 sponge Resource Report Resource Website 1+ mentions |
RRID:Addgene_25025 | CMV-miR-31 sponge | Ampicillin | PMID:19524507 | miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone. | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 1 | ||
|
pIS1-miR-335 site Resource Report Resource Website |
RRID:Addgene_25028 | synthetic miR-335 site | Ampicillin | PMID:19524507 | Renilla luciferase reporter for miR-335 constructed by cloning oligo containing synthetic miR-335 binding site (GCCAGTGAGCTCTCAAGAGCAATAACGAAAAATGTACCGGTGCCAGT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone. | Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | ||
|
pIS1-miR-206 site Resource Report Resource Website |
RRID:Addgene_25027 | synthetic miR-206 site | Ampicillin | PMID:19524507 | Renilla luciferase reporter for miR-206 constructed by cloning oligo containing synthetic miR-206 binding site (GCCATTGAGCTCTGGAATGTAAGGAAGTGTGTGGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone. | Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 0 | ||
|
pDEST51-LRRK2-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_25080 | LRRK2 | Homo sapiens | Ampicillin | PMID:18397888 | Backbone Marker:Invitrogen; Backbone Size:7464; Vector Backbone:pEF-DEST51; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:59 | 3 | ||
|
pDEST51-LRRK2-R1441C Resource Report Resource Website 1+ mentions |
RRID:Addgene_25081 | LRRK2 | Homo sapiens | Ampicillin | PMID:18397888 | Backbone Marker:Invitrogen; Backbone Size:7464; Vector Backbone:pEF-DEST51; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Ampicillin | Arginine 1441 mutated to Cysteine | Addgene | 2026-10-31 02:07:59 | 1 | |
|
PP-MECPS Resource Report Resource Website |
RRID:Addgene_25118 | Pv003920:C34523 | Plasmodium vivax | Ampicillin | PDB: 3B6N. http://www.thesgc.org/structures/3B6N/ . | Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:00 | 0 | ||
|
PP-AK Resource Report Resource Website |
RRID:Addgene_25119 | cgd5_3360:MAC029-C04:C34239 | Cryptosporidium parvum | Ampicillin | PDB: 3BE4. http://www.thesgc.org/structures/3BE4/ . | Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:00 | 0 | ||
|
PP-UBC13 (2R0J) Resource Report Resource Website |
RRID:Addgene_25114 | PFE1350c:C34884 | Plasmodium falciparum | Ampicillin | PDB: 2R0J. h http://www.thesgc.org/structures/2R0J/ . | Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains amino acid residues 3-150 | Addgene | 2026-10-31 02:08:00 | 0 | |
|
PP-SRM Resource Report Resource Website 1+ mentions |
RRID:Addgene_25110 | PF11_0301:C22904 | Plasmodium falciparum | Ampicillin | PDB: 2PT9. http://www.thesgc.org/structures/2PT9/ . | Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:00 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
