Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCS2TAL3-DD Resource Report Resource Website 10+ mentions |
RRID:Addgene_37275 | Ampicillin | PMID:22916025 | For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald | Backbone Size:4168; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 12 | |||
|
pTK21 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37396 | Ran | Homo sapiens | Kanamycin | PMID:22327364 | Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation. | Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T24N | 2026-08-15 01:14:14 | 7 |
|
pCS2TAL3-RR Resource Report Resource Website 10+ mentions |
RRID:Addgene_37276 | Ampicillin | PMID:22916025 | For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald | Backbone Size:4039; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 11 | |||
|
CFP-GAI(1-532) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37310 | GAI | Arabidopsis thaliana | Kanamycin | PMID:22446836 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | contains aa 1-532 | 2026-08-15 01:14:14 | 1 | |
|
Lyn-CFP-GAI(1-92) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37311 | GAI | Arabidopsis thaliana | Kanamycin | PMID:22446836 | Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB. | Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | contains aa 1-92 | 2026-08-15 01:14:14 | 1 |
|
10XSTAT92E–luciferase Resource Report Resource Website 1+ mentions |
RRID:Addgene_37393 | SOCS36E enhancer fragment | Drosophila melanogaster | Ampicillin | PMID:16055650 | Perrimon Lab plasmid #446 A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI). Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E. Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70. Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase. | Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 2 | |
|
pCB163 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37388 | Dynactin 2 | Homo sapiens | Ampicillin | PMID:22327364 | Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence. | Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | A7P | 2026-08-15 01:14:14 | 2 |
|
pCaSpeR-4 porcupine (genomic DNA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37376 | porcupine | Drosophila melanogaster | Ampicillin | PMID:8985181 | Perrimon Lab plasmid #123 The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct. | Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 1 | |
|
pT7-EGFP-C1-HsNot1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37370 | HsNot1 | Homo sapiens | Kanamycin | PMID:21981923 | Backbone Marker:Clontech; Backbone Size:4755; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:14 | 1 | ||
|
Renilla luciferase-Pol III Resource Report Resource Website 1+ mentions |
RRID:Addgene_37380 | PolIII-Renilla control reporter | Drosophila melanogaster | Ampicillin | PMID:16311596 | Perrimon Lab plasmid #414 The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null. | Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 6 | |
|
Cre Shine Resource Report Resource Website 1+ mentions |
RRID:Addgene_37404 | Cre Shine | Ampicillin | Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 4 | ||||
|
pTK24 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37406 | Plk1 | Homo sapiens | Kanamycin | PMID:22327364 | Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:15 | 1 | ||
|
pfast NPC1L1(NTD) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37366 | npc1l1 | Homo sapiens | Ampicillin | PMID:21525977 | There is a TEV cleavage site downstream of His tag. | Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | aa22-284only | 2026-08-15 01:14:14 | 1 |
|
pQC NLS mCherry IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37354 | NLS-mCherry | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 5 | ||
|
pQC membrane TdTomato IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37351 | membrane TdTomato | Synthetic | Ampicillin | PMID:21397594 | *palmitoylation sequence: 5'-atgctgtgctgtatgagaagaaccaaacaggttgaaaagaatgatgaggaccaaaagatc-3' | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 7 | |
|
pBAD Strep His6 TEV LIC cloning vector (8HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37505 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through | Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 1 | ||||
|
pPD95.75-wVenus Resource Report Resource Website 1+ mentions |
RRID:Addgene_37464 | Ampicillin | PMID:22022276 | Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 2 | ||||
|
myc-NLRC5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37509 | NLRC5 | Homo sapiens | Ampicillin | PMID:22490867 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 5 | ||
|
pAAV-EF1a-DIO-HB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37452 | Histone, 2A element, rabies B19 glycoprotein | Ampicillin | Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function. | Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 4 | |||
|
p6897 PHAGE-P CMVT N-HA-hE6AP III wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_37605 | E6AP III | Homo sapiens | Ampicillin | PMID:22645313 | Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:15 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
