Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:4168; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22916025
Comments: For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald
Proper citation: RRID:Addgene_37275 Copy
Species: Homo sapiens
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22327364
Comments: Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation.
Proper citation: RRID:Addgene_37396 Copy
Vector Backbone Description: Backbone Size:4039; Vector Backbone:pCS2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22916025
Comments: For more information on Grunwald TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#grunwald
Proper citation: RRID:Addgene_37276 Copy
Species: Arabidopsis thaliana
Genetic Insert: GAI
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22446836
Proper citation: RRID:Addgene_37310 Copy
Species: Arabidopsis thaliana
Genetic Insert: GAI
Vector Backbone Description: Vector Backbone:Lyn-CFP-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22446836
Comments: Lyn-CFP-FRB was created by inserting Lyn into the pEGFP- C1 vector (Clontech) whose EGFP is replaced with CFP-FRB.
Proper citation: RRID:Addgene_37311 Copy
Species: Drosophila melanogaster
Genetic Insert: SOCS36E enhancer fragment
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16055650
Comments: Perrimon Lab plasmid #446
A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI).
Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E.
Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This
hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70.
Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase.
Proper citation: RRID:Addgene_37393 Copy
Species: Homo sapiens
Genetic Insert: Dynactin 2
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22327364
Comments: Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence.
Proper citation: RRID:Addgene_37388 Copy
Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #123
The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct.
Proper citation: RRID:Addgene_37376 Copy
Species: Homo sapiens
Genetic Insert: HsNot1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4755; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21981923
Proper citation: RRID:Addgene_37370 Copy
Species: Drosophila melanogaster
Genetic Insert: PolIII-Renilla control reporter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16311596
Comments: Perrimon Lab plasmid #414
The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null.
Proper citation: RRID:Addgene_37380 Copy
Genetic Insert: Cre Shine
Vector Backbone Description: Backbone Marker:Invitrogene; Backbone Size:5060; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37404 Copy
Species: Homo sapiens
Genetic Insert: Plk1
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22327364
Proper citation: RRID:Addgene_37406 Copy
Species: Homo sapiens
Genetic Insert: npc1l1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21525977
Comments: There is a TEV cleavage site downstream of His tag.
Proper citation: RRID:Addgene_37366 Copy
Species: Synthetic
Genetic Insert: NLS-mCherry
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37354 Copy
Species: Synthetic
Genetic Insert: membrane TdTomato
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Comments: *palmitoylation sequence: 5'-atgctgtgctgtatgagaagaaccaaacaggttgaaaagaatgatgaggaccaaaagatc-3'
Proper citation: RRID:Addgene_37351 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276
Proper citation: RRID:Addgene_37464 Copy
Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867
Proper citation: RRID:Addgene_37509 Copy
Genetic Insert: Histone, 2A element, rabies B19 glycoprotein
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function.
Proper citation: RRID:Addgene_37452 Copy
Species: Homo sapiens
Genetic Insert: E6AP III
Vector Backbone Description: Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313
Proper citation: RRID:Addgene_37605 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
