Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 11 showing 201 ~ 220 out of 228 results
Snippet view Table view Download 228 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_174513

    This resource has 1+ mentions.

http://www.addgene.org/174513

Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG

Proper citation: RRID:Addgene_174513 Copy   


  • RRID:Addgene_174514

    This resource has 1+ mentions.

http://www.addgene.org/174514

Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC

Proper citation: RRID:Addgene_174514 Copy   


  • RRID:Addgene_16398

    This resource has 1+ mentions.

http://www.addgene.org/16398

Species: E. coli
Genetic Insert: BJ5183 bacterial cells
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:9482916
Comments: This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2).

Proper citation: RRID:Addgene_16398 Copy   


  • RRID:Addgene_131805

http://www.addgene.org/131805

Species: Synthetic
Genetic Insert: Zea mays FNR and Z. mays SIR
Vector Backbone Description: Vector Backbone:P15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Comments: For detailed annotations see the GenBank file under Resource Information/Supplemental Documents. Please visit https://www.biorxiv.org/content/10.1101/645978v1 for BioRxiv preprint

Proper citation: RRID:Addgene_131805 Copy   


  • RRID:Addgene_131864

    This resource has 1+ mentions.

http://www.addgene.org/131864

Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-AviTag-His6
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33659515

Proper citation: RRID:Addgene_131864 Copy   


  • RRID:Addgene_131862

http://www.addgene.org/131862

Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-RGD-His6-Cys
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31526004

Proper citation: RRID:Addgene_131862 Copy   


http://www.addgene.org/132736

Species: Synthetic
Genetic Insert: PluxB_ToeRep_N01_trigger
Vector Backbone Description: Backbone Size:3235; Vector Backbone:pCDFduet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31686032
Comments: Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_132736 Copy   


  • RRID:Addgene_126503

http://www.addgene.org/126503

Species: Pseudomonas aeruginosa SG17M
Genetic Insert: disaggregase ClpGgi with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29263094
Comments: conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M

Proper citation: RRID:Addgene_126503 Copy   


  • RRID:Addgene_137965

http://www.addgene.org/137965

Species: Zea mays
Genetic Insert: Zea mays Ferredoxin-NADP reductase
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32434930

Proper citation: RRID:Addgene_137965 Copy   


  • RRID:Addgene_137966

http://www.addgene.org/137966

Species: Zea mays
Genetic Insert: Zea mays Ferredoxin-NADP reductase
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32434930

Proper citation: RRID:Addgene_137966 Copy   


  • RRID:Addgene_104895

http://www.addgene.org/104895

Species: Phaeodactylum tricornutum
Genetic Insert: Phaeodactylum U6 promoter
Vector Backbone Description: Backbone Size:2817; Vector Backbone:pCR8/GW/TOPO; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34566902
Comments: For Golden Gated assembly. Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.

Proper citation: RRID:Addgene_104895 Copy   


  • RRID:Addgene_197272

    This resource has 1+ mentions.

http://www.addgene.org/197272

Species: Homo sapiens
Genetic Insert: huH3
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41123210

Proper citation: RRID:Addgene_197272 Copy   


  • RRID:Addgene_215468

http://www.addgene.org/215468

Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific Inc.; Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795

Proper citation: RRID:Addgene_215468 Copy   


  • RRID:Addgene_215467

http://www.addgene.org/215467

Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795

Proper citation: RRID:Addgene_215467 Copy   


  • RRID:Addgene_49808

http://www.addgene.org/49808

Species: Escherichia coli
Genetic Insert: phosphoglycerate kinase
Vector Backbone Description: Backbone Size:3810; Vector Backbone:pCDM4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23361000

Proper citation: RRID:Addgene_49808 Copy   


  • RRID:Addgene_52259

    This resource has 1+ mentions.

http://www.addgene.org/52259

Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52259 Copy   


  • RRID:Addgene_52260

    This resource has 1+ mentions.

http://www.addgene.org/52260

Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52260 Copy   


  • RRID:Addgene_52262

http://www.addgene.org/52262

Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52262 Copy   


http://www.addgene.org/215191

Species: Other
Genetic Insert: Scream2
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39943924

Proper citation: RRID:Addgene_215191 Copy   


  • RRID:Addgene_239202

http://www.addgene.org/239202

Species: Saccharomyces cerevisiae
Genetic Insert: RFC5
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_239202 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X