Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:streptomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

228 Results - per page

Show More Columns | Download 228 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Syn61
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174513 Recoded E. coli strain without TCG, TCA, or TAG codons Streptomycin PMID:31092918 The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-15 01:10:41 3
Syn61Δ3(ev5)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174514 Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes Streptomycin PMID:34083482 From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-15 01:10:41 2
BJ5183 cells
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16398 BJ5183 bacterial cells E. coli Streptomycin PMID:9482916 This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2). Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-15 01:09:17 4
pBW004
 
Resource Report
Resource Website 		RRID:Addgene_131805 Zea mays FNR and Z. mays SIR Synthetic Streptomycin For detailed annotations see the GenBank file under Resource Information/Supplemental Documents. Please visit https://www.biorxiv.org/content/10.1101/645978v1 for BioRxiv preprint Vector Backbone:P15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-15 01:05:20 0
pMH1105
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_131864 PhyB(1-651)-AviTag-His6 Arabidopsis thaliana Streptomycin PMID:33659515 Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:05:21 2
pMH610
 
Resource Report
Resource Website 		RRID:Addgene_131862 PhyB(1-651)-RGD-His6-Cys Arabidopsis thaliana Streptomycin PMID:31526004 Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:05:21 0
pAG_PluxB_ToeRep_N01_trigger
 
Resource Report
Resource Website 		RRID:Addgene_132736 PluxB_ToeRep_N01_trigger Synthetic Streptomycin PMID:31686032 Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint. Backbone Size:3235; Vector Backbone:pCDFduet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:05:31 0
pSG020
 
Resource Report
Resource Website 		RRID:Addgene_126503 disaggregase ClpGgi with 6xHis-tag Pseudomonas aeruginosa SG17M Streptomycin PMID:29263094 conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:04:26 0
pSAC16
 
Resource Report
Resource Website 		RRID:Addgene_137965 Zea mays Ferredoxin-NADP reductase Zea mays Streptomycin PMID:32434930 Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-15 01:06:18 0
pSAC17
 
Resource Report
Resource Website 		RRID:Addgene_137966 Zea mays Ferredoxin-NADP reductase Zea mays Streptomycin PMID:32434930 Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-15 01:06:18 0
pCR8/GW:PtU6
 
Resource Report
Resource Website 		RRID:Addgene_104895 Phaeodactylum U6 promoter Phaeodactylum tricornutum Streptomycin PMID:34566902 For Golden Gated assembly. Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint. Backbone Size:2817; Vector Backbone:pCR8/GW/TOPO; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-15 01:00:49 0
His-huH3-huH4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_197272 huH3 Homo sapiens Streptomycin PMID:41123210 Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:34:16 1
pENTR223-ABL2(K281M)
 
Resource Report
Resource Website 		RRID:Addgene_215468 ABL2 Homo sapiens Streptomycin PMID:40419795 Backbone Marker:Thermo Fisher Scientific Inc.; Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin K281M (kinase-inactivating) 2026-08-15 01:33:49 0
pENTR223-ABL2(WT)
 
Resource Report
Resource Website 		RRID:Addgene_215467 ABL2 Homo sapiens Streptomycin PMID:40419795 Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin Includes stop codon 2026-08-15 01:33:49 0
pCDM4-GLY
 
Resource Report
Resource Website 		RRID:Addgene_49808 phosphoglycerate kinase Escherichia coli Streptomycin PMID:23361000 Backbone Size:3810; Vector Backbone:pCDM4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:16:04 0
pSUMO2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_52259 SUMO-2 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-15 01:16:21 5
pSUMO3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_52260 SUMO-3 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-15 01:16:21 2
pSA2
 
Resource Report
Resource Website 		RRID:Addgene_52262 SUMO-2 Homo sapiens Streptomycin PMID:25007328 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin C-terminal gly-gly 2026-08-15 01:16:21 0
Hv_HPT:pCSRM2C:Gus_introns
 
Resource Report
Resource Website 		RRID:Addgene_215191 Scream2 Other Streptomycin PMID:39943924 Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-15 01:32:56 0
Sc RFC5-pCDFDuet
 
Resource Report
Resource Website 		RRID:Addgene_239202 RFC5 Saccharomyces cerevisiae Streptomycin Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:33:02 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch