Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: 2x43-8 ZFO-1x97-4 ZFO pCyc mCherry tCyc
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34469745
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_174063 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GALL promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2574; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).
Proper citation: RRID:Addgene_17418 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MET3 promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Size:2581; Vector Backbone:p404ADH1; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_17419 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter + polylinker + CYC1 terminator
Vector Backbone Description: Backbone Marker:Sikorski & Hieter, Genetics 122:19-27 (1989); Backbone Size:2691; Vector Backbone:pRS406; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Mumberg D, Muller R, Funk M. Nucleic Acids Res. 25:5767-8 (1994).
Proper citation: RRID:Addgene_17437 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 11R Unique
Vector Backbone Description: Backbone Marker:ThermoFisher; Backbone Size:3956; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34702734
Proper citation: RRID:Addgene_174830 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Met4 UIML
Vector Backbone Description: Vector Backbone:pet28(a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34763062
Proper citation: RRID:Addgene_174888 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163582 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163581 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163585 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163580 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ARG3pr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164709 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GALLpr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: This plasmid was made by Catherine Oikonomou in Dr. Cross's lab.
yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164702 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CUP1pr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164703 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1pr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164707 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: tetOpr - yEVenus - CLN2 PEST - ADH1t
Vector Backbone Description: Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37369667
Comments: yEVenus is a codon-optimized yEGFP variant with F46L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y mutations. Please visit https://www.biorxiv.org/content/10.1101/2020.08.16.253310v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_164705 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: P(Z)-mcherry
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pNTI661; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33303588
Proper citation: RRID:Addgene_164918 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VP2C-GLuc
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182213 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VP2C-Akaluc
Vector Backbone Description: Vector Backbone:pILGFPB5A; Vector Types:Yeast Expression, Synthetic Biology, TEM imaging; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182212 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
