Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: UBC promoter - GFP - PGK promoter - Hygro
Vector Backbone Description: Backbone Size:0; Vector Backbone:Duet011; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17158240
Comments: Lentiviral dual promoter/dual-gene expression vector is dubbed Duet (for Dual-gene, excisable transgene).
Proper citation: RRID:Addgene_17627 Copy
Vector Backbone Description: Backbone Size:5897; Vector Backbone:pMVS223; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35120642
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.10.28.359026v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176293 Copy
Species: Atlantic deep subsurface metagenome
Genetic Insert: human codon optimized Cas13bt1
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34462587
Proper citation: RRID:Addgene_176316 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Osh4
Vector Backbone Description: Backbone Size:5000; Vector Backbone:modified pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16136145
Comments: DNA encoding Osh4 residues 2–434 was amplified by PCR and subcloned into the BamHI and XhoI sites of a pGEX-4T vector modified to contain a TEV protease recognition site.
Proper citation: RRID:Addgene_17632 Copy
Species: Homo sapiens
Genetic Insert: VPS13D
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3679; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33891012
Comments: GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression.
Proper citation: RRID:Addgene_176462 Copy
Species: Homo sapiens
Genetic Insert: HP1 beta
Vector Backbone Description: Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12560555
Comments: See author's map for more information.
Proper citation: RRID:Addgene_17651 Copy
Species: Homo sapiens
Genetic Insert: HP1 alpha
Vector Backbone Description: Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12560555
Comments: See author's map for more information.
Proper citation: RRID:Addgene_17652 Copy
Species: Homo sapiens
Genetic Insert: D50 lamin A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15750600
Proper citation: RRID:Addgene_17653 Copy
Species: E. coli, Brachypodium distachyon, Delaware Bay metagenome
Genetic Insert: CRISPR-associated IscB (Delaware Bay metagenome)
Vector Backbone Description: Backbone Size:5062; Vector Backbone:pET45b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34591643
Proper citation: RRID:Addgene_176534 Copy
Vector Backbone Description: Backbone Size:5558; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2194165
Comments: Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication:
Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC.
Please note that the sequence from which the Addgene map was generated is an estimate of the real sequence based on how the vector was assembled. We encourage scientists to test enzymes before using them for cloning.
Proper citation: RRID:Addgene_1765 Copy
Species: Mus musculus
Genetic Insert: trim46
Vector Backbone Description: Vector Backbone:?pGW1-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26671463
Proper citation: RRID:Addgene_176402 Copy
Species: Homo sapiens
Genetic Insert: Alix (360-702)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17277784
Comments: The vector backbone, parallel GST2, was made by replacing the polylinker of pGEX4T1 with the polylinker isolated from the baculovirus expression plasmid pFastBac (see PMID: 10024467).
Proper citation: RRID:Addgene_17639 Copy
Species: Homo sapiens
Genetic Insert: BACH1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1(+)/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14983014
Proper citation: RRID:Addgene_17643 Copy
Species: Hepatitis C virus
Genetic Insert: HCV NS5A
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMVTag1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17404395
Proper citation: RRID:Addgene_17646 Copy
Species: Homo sapiens
Genetic Insert: CRM1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6400; Vector Backbone:p3xFLAG CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16041368
Proper citation: RRID:Addgene_17647 Copy
Species: Homo sapiens
Genetic Insert: GLI2
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15994174
Proper citation: RRID:Addgene_17649 Copy
Species: Aggregatibacter actinomycetemcomitans
Genetic Insert: Dispersin B
Vector Backbone Description: Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35379435
Proper citation: RRID:Addgene_176577 Copy
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Proper citation: RRID:Addgene_176583 Copy
Species: Mus musculus
Genetic Insert: mVenus-p27K-
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34079127
Proper citation: RRID:Addgene_176651 Copy
Genetic Insert: lac I-SceI tet
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17486118
Comments: The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta
plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI).
lac operator repeat: tggaattgtgagcggataacaatt
tet operator repeat: tccctatcagtgatagaga
This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt.
Proper citation: RRID:Addgene_17655 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
