Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:arabidopsis thaliana (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,244 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
NtDRMcd-dCas9 (M12)
 
Resource Report
Resource Website 		RRID:Addgene_239481 RPS5A-NtDRMcd-XTEN80-NLS-dCas9-2xNLS-P2A-BFP Arabidopsis thaliana Kanamycin PMID:41353342 Vector Backbone:pCAMBIA1300; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:35:07 0
TET1cd-dCas9 (D12)
 
Resource Report
Resource Website 		RRID:Addgene_239488 RPS5A-TET1cd-XTEN80-NLS-dCas9-2xNLS-P2A-BFP Arabidopsis thaliana Kanamycin PMID:41353342 Vector Backbone:pCAMBIA1300; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:35:10 0
ROS1-dCas9 (D10)
 
Resource Report
Resource Website 		RRID:Addgene_239487 RPS5A-ROS1-XTEN80-NLS-dCas9-2xNLS-P2A-BFP Arabidopsis thaliana Kanamycin PMID:41353342 Vector Backbone:pCAMBIA1300; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:35:07 0
pHAGE-dCas9-3XmCherry-CRY2
 
Resource Report
Resource Website 		RRID:Addgene_249580 CRY2hiclu Arabidopsis thaliana Ampicillin PMID:41549960 Please refer to related article for further details about origin and use of this plasmid. CRY2 was cloned into vector made by Thoru Pederson lab (Addgene #64108). Please visit https://doi.org/10.1101/2025.11.06.686574 for bioRxiv preprint. Backbone Size:6607; Vector Backbone:pHAGE-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:35:12 0
pFA6a-mIAA7-mCherry-klTRP1
 
Resource Report
Resource Website 		RRID:Addgene_247623 mIAA7 Arabidopsis thaliana Ampicillin PMID:41400934 Also known as pSS1625. Please visit https://doi.org/10.1101/2025.09.24.678194 for bioRxiv preprint. Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:35:18 0
pICH41258_H2B
 
Resource Report
Resource Website 		RRID:Addgene_232557 AtH2B Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 47987); Vector Backbone:pICH41258; Vector Types:Coding Sequence; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pAGM9121_HSP-ter
 
Resource Report
Resource Website 		RRID:Addgene_232554 HSP terminator Arabidopsis thaliana Spectinomycin PMID:41918164 Backbone Marker:Sylvestre Marillonnet (Addgene plasmid # 51833); Vector Backbone:pAGM9121; Vector Types:Terminator; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:20 0
pZZ006-AlcA::DM2h[Bla-1]-Myc
 
Resource Report
Resource Website 		RRID:Addgene_246384 DM2h[Bla-1] Arabidopsis thaliana Spectinomycin Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:35:44 0
pZZ006-AlcA::DM2h[Bla-1] G301A K302A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_246383 DM2h[Bla-1] Arabidopsis thaliana Spectinomycin Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin TGGGATTGGTAAGACAACTAT to TGGGATTGCTGCGACAACTAT amino acid G301A K302A 2026-08-15 01:35:44 0
pB1K-BUP
 
Resource Report
Resource Website 		RRID:Addgene_256022 BSL1/BSU1 chimera Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin chimera 2026-08-15 01:35:50 0
pBSL1
 
Resource Report
Resource Website 		RRID:Addgene_256017 BSL1 Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:35:54 0
pBSL3
 
Resource Report
Resource Website 		RRID:Addgene_256019 BSL3 Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:35:54 0
pBSL2
 
Resource Report
Resource Website 		RRID:Addgene_256018 BSL2 Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:35:54 0
pB2K-BUP
 
Resource Report
Resource Website 		RRID:Addgene_256024 BSL2/BSU1 chimera Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin chimera 2026-08-15 01:35:54 0
pBSL2dIII
 
Resource Report
Resource Website 		RRID:Addgene_256028 BSL2 mutant Arabidopsis thaliana Kanamycin PMID:42412928 Vector Backbone:pCambia-3300; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 787H>N 2026-08-15 01:35:54 0
pG20_KEA1_TEV_mVenus_FR
 
Resource Report
Resource Website 		RRID:Addgene_244953 kea1 Arabidopsis thaliana Kanamycin PMID:41222448 Backbone Size:6744; Vector Backbone:pGreen2.0; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:29 0
pG20_KEA1_TEV_mCherry_FR
 
Resource Report
Resource Website 		RRID:Addgene_244956 kea1 Arabidopsis thaliana Kanamycin PMID:41222448 Backbone Size:6735; Vector Backbone:pGreen2.0; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:29 0
pG20_KEA1_TEV_HA_FR
 
Resource Report
Resource Website 		RRID:Addgene_244961 kea1 Arabidopsis thaliana Kanamycin PMID:41222448 Backbone Size:6069; Vector Backbone:pGreen2.0; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:29 0
pG20_KEA1_TEV_MYC_FR
 
Resource Report
Resource Website 		RRID:Addgene_244960 kea1 Arabidopsis thaliana Kanamycin PMID:41222448 Backbone Size:6075; Vector Backbone:pGreen2.0; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:29 0
pFA6a-mIAA7-3xFLAG-kanNP1
 
Resource Report
Resource Website 		RRID:Addgene_247620 mIAA7 Arabidopsis thaliana Ampicillin PMID:41400934 Also known as pSS1616. Please visit https://doi.org/10.1101/2025.09.24.678194 for bioRxiv preprint. Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch