Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pFRT/TO/HIS/FLAG/HA-PRDX1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38086 | PRDX1 peroxiredoxin 1 | Homo sapiens | Ampicillin | PMID:22681889 | Backbone Size:5321; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 5 | ||
|
PJ-Sac Resource Report Resource Website 1+ mentions |
RRID:Addgene_38000 | FKBP1A | Homo sapiens | Kanamycin | PMID:22722250 | Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information. | Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:18 | 9 | |
|
MSCV-N EBNA3C Resource Report Resource Website 1+ mentions |
RRID:Addgene_37958 | EBNA3C | H. Herpesvirus 4 (EBV) | Ampicillin | PMID:22810586 | Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [FLYKVVR] fused to the C-terminus of translated protein. | Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:18 | 1 | |
|
MSCV-N BNLF2a Resource Report Resource Website 1+ mentions |
RRID:Addgene_37941 | BNLF2a | H. Herpesvirus 4 (EBV) | Ampicillin | PMID:22810586 | Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, leaving additional amino acid residues [PTFLYKVVR] fused to the C-terminus of translated protein. | Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:18 | 1 | |
|
pFRT/TO/HIS/FLAG/HA-MYBBP1A Resource Report Resource Website 1+ mentions |
RRID:Addgene_38084 | MYBBP1A MYB binding protein (P160) 1a | Homo sapiens | Ampicillin | PMID:22681889 | Backbone Size:5499; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | ||
|
pFRT/TO/HIS/FLAG/HA-HNRNPR Resource Report Resource Website 1+ mentions |
RRID:Addgene_38067 | HNRNPR heterogeneous nuclear ribonucleoprotein R | Homo sapiens | Ampicillin | PMID:22681889 | Backbone Size:5538; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | ||
|
pFRT/TO/HIS/FLAG/HA-HNRNPU Resource Report Resource Website 1+ mentions |
RRID:Addgene_38068 | HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) | Homo sapiens | Ampicillin | PMID:22681889 | Backbone Size:5496; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | ||
|
MSCV-N E4orf1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38063 | E4 orf1 | Human adenovirus 5 | Ampicillin | PMID:22810586 | Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [STFLYKVVR] fused to the C-terminus of translated protein. | Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 4 | |
|
pFRT/TO/HIS/FLAG/HA-HNRNPD Resource Report Resource Website 1+ mentions |
RRID:Addgene_38066 | HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) | Homo sapiens | Ampicillin | PMID:22681889 | Backbone Size:5496; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 4 | ||
|
pAAV-EF1a-FLEX-TVA-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_38044 | Avian sarcoma and leukemia virus receptor 950 | Synthetic | Ampicillin | PMID:22681690 | Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 23 | ||
|
EYFP-Abr in pCCL-cppt178-MNDU3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38155 | Abr | Homo sapiens | Ampicillin | PMID:17116687 | Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I. | Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | |
|
pPK719 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38149 | cbr-unc-119::FRT*::galk::FRT* | Caenorhabditis elegans | Ampicillin | This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene. The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:19 | 1 | ||
|
RCIscript-GoldyTALEN Resource Report Resource Website 10+ mentions |
RRID:Addgene_38142 | GoldyTALEN | Synthetic | Ampicillin | PMID:23027955 | Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer. The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid. For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson | Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | Truncate at N and C terminous | 2026-08-15 01:14:19 | 18 |
|
pC-GoldyTALEN Resource Report Resource Website 10+ mentions |
RRID:Addgene_38143 | GoldyTALEN | Synthetic | Ampicillin | PMID:23027955 | For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson | Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Truncate at N and C terminous | 2026-08-15 01:14:19 | 12 |
|
pcDNA4-FLAG-Jhdm2a Resource Report Resource Website 1+ mentions |
RRID:Addgene_38136 | Jhdm2a | Mus musculus | Ampicillin | PMID:22722204 | Backbone Size:5100; Vector Backbone:pcDNA4/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | protein starts at aa115 | 2026-08-15 01:14:19 | 3 | |
|
pEGFP-N1-MITF-A Resource Report Resource Website 1+ mentions |
RRID:Addgene_38132 | MITF-A | Homo sapiens | Kanamycin | PMID:22692423 | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | deleted stop codon | 2026-08-15 01:14:19 | 9 | |
|
pCW57.1-4EBP1_4xAla Resource Report Resource Website 10+ mentions |
RRID:Addgene_38240 | 4EBP1 | Rattus norvegicus | Ampicillin | PMID:22552098 | Backbone Marker:Broad Insitute; Backbone Size:5000; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible; Bacterial Resistance:Ampicillin | T37A, T46A, S65A, T70A (dominant negative) | 2026-08-15 01:14:20 | 15 | |
|
pEBB HA cIAP1 H588A Resource Report Resource Website 1+ mentions |
RRID:Addgene_38233 | cIAP1 H588A | Homo sapiens | Ampicillin | PMID:19243308 | Backbone Marker:Baltimore Lab; Backbone Size:5350; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | H588A | 2026-08-15 01:14:20 | 1 | |
|
pMXs-IP-EGFP-LC3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_38195 | microtubule-associated protein 1 light chain 3 beta | Rattus norvegicus | Ampicillin | PMID:18443221 | Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:20 | 2 | ||
|
pMXs-IP-EGFP-ULK1(K46N) Resource Report Resource Website 1+ mentions |
RRID:Addgene_38197 | a novel protein kinase structurally related to C. elegans UNC-51 | Mus musculus | Ampicillin | PMID:18443221 | Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed Lysine 46 to Asparagine | 2026-08-15 01:14:20 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
