Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 113 showing 2241 ~ 2260 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_44170

    This resource has 1+ mentions.

http://www.addgene.org/44170

Species: Influenza virus (A/chicken/Rostock/8/34)
Genetic Insert: Influenza A virus M2 matrix gene
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23319179

Proper citation: RRID:Addgene_44170 Copy   


  • RRID:Addgene_44172

http://www.addgene.org/44172

Species: E. coli
Genetic Insert: LacZ
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:2700; Vector Backbone:pCI; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16397505

Proper citation: RRID:Addgene_44172 Copy   


  • RRID:Addgene_44175

    This resource has 1+ mentions.

http://www.addgene.org/44175

Species: Saccharomyces cerevisiae
Genetic Insert: Atg17
Vector Backbone Description: Backbone Size:5756; Vector Backbone:pJK59; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23219485
Comments: Constructed by amplifying Atg17 with 300bp 5' of the start site.

Proper citation: RRID:Addgene_44175 Copy   


http://www.addgene.org/44167

Species: E. coli
Genetic Insert: LacZ
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:2700; Vector Backbone:pCI; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23319179

Proper citation: RRID:Addgene_44167 Copy   


  • RRID:Addgene_44160

    This resource has 1+ mentions.

http://www.addgene.org/44160

Species: Mus musculus
Genetic Insert: Tak1
Vector Backbone Description: Vector Backbone:pRK6-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16260783

Proper citation: RRID:Addgene_44160 Copy   


  • RRID:Addgene_44163

    This resource has 1+ mentions.

http://www.addgene.org/44163

Genetic Insert: firefly luciferase
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:2700; Vector Backbone:pCI; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23319179

Proper citation: RRID:Addgene_44163 Copy   


  • RRID:Addgene_44317

http://www.addgene.org/44317

Species: Yarrowia lipolytica
Genetic Insert: UAS1B9-Leum promoter
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21926196

Proper citation: RRID:Addgene_44317 Copy   


  • RRID:Addgene_44318

http://www.addgene.org/44318

Species: Yarrowia lipolytica
Genetic Insert: UAS1B10-Leum promoter
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21926196

Proper citation: RRID:Addgene_44318 Copy   


  • RRID:Addgene_44311

http://www.addgene.org/44311

Species: Yarrowia lipolytica
Genetic Insert: UAS1B3-Leum promoter
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21926196
Comments: Discrepancies between the Addgene QC sequence and the depositor's sequence should not affect plasmid function.

Proper citation: RRID:Addgene_44311 Copy   


  • RRID:Addgene_44310

http://www.addgene.org/44310

Species: Yarrowia lipolytica
Genetic Insert: UAS1B2-Leum promoter
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21926196
Comments: Discrepancies between the Addgene QC sequence and the depositor's sequence should not affect plasmid function.

Proper citation: RRID:Addgene_44310 Copy   


  • RRID:Addgene_44312

http://www.addgene.org/44312

Species: Yarrowia lipolytica
Genetic Insert: UAS1B4-Leum promoter
Vector Backbone Description: Backbone Size:2623; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21926196
Comments: Discrepancies between the Addgene QC sequence and the depositor's sequence should not affect plasmid function.

Proper citation: RRID:Addgene_44312 Copy   


  • RRID:Addgene_44271

http://www.addgene.org/44271

Species: Synthetic
Genetic Insert: PAiRFP2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4064; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23842578

Proper citation: RRID:Addgene_44271 Copy   


  • RRID:Addgene_44264

    This resource has 1+ mentions.

http://www.addgene.org/44264

Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14708593
Comments: Alternate plasmid name: K15(-4.8)-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega). The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI.

Proper citation: RRID:Addgene_44264 Copy   


  • RRID:Addgene_44267

http://www.addgene.org/44267

Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16288281
Comments: Alternate plasmid name: K15-HSV-TK-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264). The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase. The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.

Proper citation: RRID:Addgene_44267 Copy   


  • RRID:Addgene_44268

    This resource has 1+ mentions.

http://www.addgene.org/44268

Genetic Insert: SypHy1x-tdimer2(12)
Vector Backbone Description: Vector Backbone:pMH4; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23522046

Proper citation: RRID:Addgene_44268 Copy   


  • RRID:Addgene_44250

    This resource has 10+ mentions.

http://www.addgene.org/44250

Species: S .pyogenes
Genetic Insert: wild-type Cas9
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860

Proper citation: RRID:Addgene_44250 Copy   


  • RRID:Addgene_44251

    This resource has 50+ mentions.

http://www.addgene.org/44251

Genetic Insert: guide RNA (bacteria)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860

Proper citation: RRID:Addgene_44251 Copy   


  • RRID:Addgene_44248

    This resource has 50+ mentions.

http://www.addgene.org/44248

Species: Homo sapiens
Genetic Insert: guide RNA
Vector Backbone Description: Vector Backbone:pU6; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860

Proper citation: RRID:Addgene_44248 Copy   


  • RRID:Addgene_44240

    This resource has 1+ mentions.

http://www.addgene.org/44240

Species: Mus musculus
Genetic Insert: Pyruvate Kinase M1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823

Proper citation: RRID:Addgene_44240 Copy   


  • RRID:Addgene_44239

    This resource has 1+ mentions.

http://www.addgene.org/44239

Species: Mus musculus
Genetic Insert: Pyruvate Kinase M2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823

Proper citation: RRID:Addgene_44239 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X