Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 113 showing 2241 ~ 2260 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_41828

http://www.addgene.org/41828

Vector Backbone Description: Backbone Size:3580; Vector Backbone:pUG66; Vector Types:Yeast Expression, PCR template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21393538

Proper citation: RRID:Addgene_41828 Copy   


  • RRID:Addgene_41815

    This resource has 100+ mentions.

http://www.addgene.org/41815

Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287722
Comments: For additional information: http://arep.med.harvard.edu/human_crispr/

Proper citation: RRID:Addgene_41815 Copy   


  • RRID:Addgene_41814

    This resource has 50+ mentions.

http://www.addgene.org/41814

Species: Homo sapiens
Genetic Insert: SOX2, KLF4
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063

Proper citation: RRID:Addgene_41814 Copy   


  • RRID:Addgene_41811

http://www.addgene.org/41811

Species: Homo sapiens
Genetic Insert: H9 Super-2
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627
Comments: This is an e. coli periplasmic expression vector. H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F

Proper citation: RRID:Addgene_41811 Copy   


  • RRID:Addgene_41818

    This resource has 50+ mentions.

http://www.addgene.org/41818

Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT

Proper citation: RRID:Addgene_41818 Copy   


  • RRID:Addgene_41817

    This resource has 10+ mentions.

http://www.addgene.org/41817

Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG

Proper citation: RRID:Addgene_41817 Copy   


  • RRID:Addgene_41807

http://www.addgene.org/41807

Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627

Proper citation: RRID:Addgene_41807 Copy   


  • RRID:Addgene_41806

http://www.addgene.org/41806

Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627

Proper citation: RRID:Addgene_41806 Copy   


  • RRID:Addgene_41758

http://www.addgene.org/41758

Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212149

Proper citation: RRID:Addgene_41758 Copy   


  • RRID:Addgene_41755

http://www.addgene.org/41755

Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212149

Proper citation: RRID:Addgene_41755 Copy   


  • RRID:Addgene_41753

http://www.addgene.org/41753

Species: Drosophila melanogaster
Genetic Insert: kinesin heavy chain
Vector Backbone Description: Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212149

Proper citation: RRID:Addgene_41753 Copy   


  • RRID:Addgene_41742

    This resource has 1+ mentions.

http://www.addgene.org/41742

Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21725302
Comments: Alternate plasmid name: pCDNA5-KGH2

Proper citation: RRID:Addgene_41742 Copy   


  • RRID:Addgene_41740

http://www.addgene.org/41740

Species: Mus musculus
Genetic Insert: Klf5
Vector Backbone Description: Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17158781

Proper citation: RRID:Addgene_41740 Copy   


  • RRID:Addgene_41699

    This resource has 1+ mentions.

http://www.addgene.org/41699

Genetic Insert: E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22904085

Proper citation: RRID:Addgene_41699 Copy   


http://www.addgene.org/41739

Species: Mus musculus
Genetic Insert: Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10882062
Comments: Alternate plasmid name: pCS2 NLNR CC>SS-6MT All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738).

Proper citation: RRID:Addgene_41739 Copy   


  • RRID:Addgene_41730

    This resource has 1+ mentions.

http://www.addgene.org/41730

Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9620803
Comments: Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).

Proper citation: RRID:Addgene_41730 Copy   


  • RRID:Addgene_41695

    This resource has 1+ mentions.

http://www.addgene.org/41695

Species: Pyrococcus horikoshii
Genetic Insert: PhoCDC21-1 intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202

Proper citation: RRID:Addgene_41695 Copy   


  • RRID:Addgene_41694

http://www.addgene.org/41694

Species: Methanococcus jannaschii
Genetic Insert: MjaTFIIB intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202

Proper citation: RRID:Addgene_41694 Copy   


  • RRID:Addgene_41847

http://www.addgene.org/41847

Species: Homo sapiens
Genetic Insert: DNAJA4 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23142051
Comments: Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector

Proper citation: RRID:Addgene_41847 Copy   


http://www.addgene.org/41968

Species: Homo sapiens
Genetic Insert: BRCA1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10550055
Comments: The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate.

Proper citation: RRID:Addgene_41968 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X