Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11585930
Proper citation: RRID:Addgene_21091 Copy
Species: Mus musculus
Genetic Insert: MEIS1B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10082572
Proper citation: RRID:Addgene_21022 Copy
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:in vitro TNT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11585930
Proper citation: RRID:Addgene_21026 Copy
Species: Mus musculus
Genetic Insert: MSX2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5376; Vector Backbone:pET-28c; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9373945
Proper citation: RRID:Addgene_21025 Copy
Species: Mus musculus
Genetic Insert: MEIS1B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3300; Vector Backbone:pVP16; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21020 Copy
Species: Mus musculus
Genetic Insert: Oct4
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19171782
Proper citation: RRID:Addgene_21110 Copy
Species: Mus musculus
Genetic Insert: HOXD8
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21005 Copy
Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Marker:Stratagene (originally); Backbone Size:4000; Vector Backbone:pBluescript derivative; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21004 Copy
Species: Mus musculus
Genetic Insert: Rorgt
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_24069 Copy
Species: Mus musculus
Genetic Insert: IL23R
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: IL23R cDNA amplified through IL6 treated cDNA as 2 parts (5' part ATG-134-BamHI; 3' part 134-STOP).
5' part cloned into pcDNA3 XhoI/BamHI
3' part cloned into MSCV hCD2
Part linked together in pcDNA3 (XhoI-MluI)
Then cut with XhoI/NruI cloned into pMIGR (XhoI/HpaI)
Proper citation: RRID:Addgene_24066 Copy
Species: Mus musculus
Genetic Insert: Foxp3
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:7894; Vector Backbone:MSCV-LTRmiR30-PIG (LMP); Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18368049
Comments: The target sequence of Foxp3: 5′-GGCAGAGGACACTCAATGAAAT-3′
Proper citation: RRID:Addgene_24071 Copy
Species: Mus musculus
Genetic Insert: DLC2
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12591950
Proper citation: RRID:Addgene_24269 Copy
Species: Mus musculus
Genetic Insert: DLC2
Vector Backbone Description: Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12591950
Proper citation: RRID:Addgene_24270 Copy
Species: Mus musculus
Genetic Insert: nAChR beta2 WT
Vector Backbone Description: Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14684858
Proper citation: RRID:Addgene_24272 Copy
Species: Mus musculus
Genetic Insert: pLLOXmPOLbeta
Vector Backbone Description: Backbone Marker:Obtained from MIT vector core; Backbone Size:70000; Vector Backbone:pLentiLox3.7; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20096707
Comments: shRNA oligo sequence is - 5'-TGATCAGTACTACTGTGGTGTTCAAGAGACACCACAGTAGTACTGATCTTTTTTC
Proper citation: RRID:Addgene_24174 Copy
Species: Mus musculus
Genetic Insert: pIRES.Puro.mBeta
Vector Backbone Description: Backbone Marker:Clontech (Unmodified); Backbone Size:6000; Vector Backbone:pIRESpuro-modified with gateway cassette by recombination clonin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20096707
Comments: Mouse pol beta cDNA was cloned into pENTR-D (invitrogen). The mouse pol beta open reading frame was transferred from pENTRD-mPOL beta to a gateway modified pIRES-Puro plasmid via LR recombination reaction.
Proper citation: RRID:Addgene_24175 Copy
Species: Mus musculus
Genetic Insert: EF1alpha-betacatenin(deltaGSK) // SV40-PuroR
Vector Backbone Description: Backbone Marker:Naldini/Trono (Addgene #12252); Backbone Size:6074; Vector Backbone:pRRLSIN.cPPT.PGK-GFP.WPRE ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20186325
Comments: This plasmid requires a 2nd generation lentiviral packaging system.
Proper citation: RRID:Addgene_24313 Copy
Species: Mus musculus
Genetic Insert: Foxo1
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_24379 Copy
Species: Mus musculus
Genetic Insert: Ofd1
Vector Backbone Description: Backbone Size:4501; Vector Backbone:pBluescript; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19966808
Comments: Also see the following article:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles.
Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF.
Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748
Proper citation: RRID:Addgene_24559 Copy
Species: Mus musculus
Genetic Insert: Long chain acyl-CoA dehydrogenase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20203611
Proper citation: RRID:Addgene_24486 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
