Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Vmn2r120
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108087 Copy
Species: Mus musculus
Genetic Insert: Vmn2r118
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108086 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are:
5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3'
3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108117 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AATCAATTGCCTGACAATC), the annealed oligos were:
5'-gatccAATCAATTGCCTGACAATCTTCAAGAGAGATTGTCAGGCAATTGATTTTTTTTACGCGTg-----3'
3'-gTTAGTTAACGGACTGTTAGAAGTTCTCTCTAACAGTCCGTTAACTAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108115 Copy
Species: Mus musculus
Genetic Insert: Vmn2r1-Hprt (5')-loxP-neo
Vector Backbone Description: Backbone Marker:Agilent Technologies/Stratagene; Backbone Size:2900; Vector Backbone:pBluescript II SK+; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108079 Copy
Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108403 Copy
Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108402 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108395 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108392 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108390 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108398 Copy
Species: Mus musculus
Genetic Insert: dCas9, MLL3
Vector Backbone Description: Vector Backbone:pCMV7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29313530
Proper citation: RRID:Addgene_108452 Copy
Species: Mus musculus
Genetic Insert: NMHC II-C
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14594953
Proper citation: RRID:Addgene_10843 Copy
Species: Mus musculus
Genetic Insert: RANKL (receptor activator of nuclear factor kappa-B ligand)
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17419679
Proper citation: RRID:Addgene_108571 Copy
Species: Mus musculus
Genetic Insert: Zfp521
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pCMV Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27107743
Comments: deletion of final six Zn fingers
Proper citation: RRID:Addgene_104190 Copy
Species: Mus musculus
Genetic Insert: Zfp521
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pCMV Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27107743
Proper citation: RRID:Addgene_104189 Copy
Species: Mus musculus
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24908396
Proper citation: RRID:Addgene_104561 Copy
Species: Mus musculus
Genetic Insert: Mouse CL kappa
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Proper citation: RRID:Addgene_104579 Copy
Species: Mus musculus
Genetic Insert: Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Proper citation: RRID:Addgene_104581 Copy
Species: Mus musculus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297
Proper citation: RRID:Addgene_104589 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.