Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 115 showing 2281 ~ 2300 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_108087

http://www.addgene.org/108087

Species: Mus musculus
Genetic Insert: Vmn2r120
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108087 Copy   


  • RRID:Addgene_108086

http://www.addgene.org/108086

Species: Mus musculus
Genetic Insert: Vmn2r118
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108086 Copy   


http://www.addgene.org/108117

Species: Mus musculus
Genetic Insert: shRNA to Egr4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are: 5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3' 3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'

Proper citation: RRID:Addgene_108117 Copy   


http://www.addgene.org/108115

Species: Mus musculus
Genetic Insert: shRNA to Egr3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AATCAATTGCCTGACAATC), the annealed oligos were: 5'-gatccAATCAATTGCCTGACAATCTTCAAGAGAGATTGTCAGGCAATTGATTTTTTTTACGCGTg-----3' 3'-gTTAGTTAACGGACTGTTAGAAGTTCTCTCTAACAGTCCGTTAACTAAAAAAAATGCGCActtaa-5'

Proper citation: RRID:Addgene_108115 Copy   


  • RRID:Addgene_108079

http://www.addgene.org/108079

Species: Mus musculus
Genetic Insert: Vmn2r1-Hprt (5')-loxP-neo
Vector Backbone Description: Backbone Marker:Agilent Technologies/Stratagene; Backbone Size:2900; Vector Backbone:pBluescript II SK+; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786

Proper citation: RRID:Addgene_108079 Copy   


http://www.addgene.org/108403

Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108403 Copy   


  • RRID:Addgene_108402

http://www.addgene.org/108402

Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108402 Copy   


  • RRID:Addgene_108395

http://www.addgene.org/108395

Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108395 Copy   


  • RRID:Addgene_108392

http://www.addgene.org/108392

Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108392 Copy   


http://www.addgene.org/108390

Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108390 Copy   


  • RRID:Addgene_108398

http://www.addgene.org/108398

Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897

Proper citation: RRID:Addgene_108398 Copy   


  • RRID:Addgene_108452

http://www.addgene.org/108452

Species: Mus musculus
Genetic Insert: dCas9, MLL3
Vector Backbone Description: Vector Backbone:pCMV7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29313530

Proper citation: RRID:Addgene_108452 Copy   


  • RRID:Addgene_10843

    This resource has 1+ mentions.

http://www.addgene.org/10843

Species: Mus musculus
Genetic Insert: NMHC II-C
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14594953

Proper citation: RRID:Addgene_10843 Copy   


  • RRID:Addgene_108571

    This resource has 1+ mentions.

http://www.addgene.org/108571

Species: Mus musculus
Genetic Insert: RANKL (receptor activator of nuclear factor kappa-B ligand)
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17419679

Proper citation: RRID:Addgene_108571 Copy   


  • RRID:Addgene_104190

http://www.addgene.org/104190

Species: Mus musculus
Genetic Insert: Zfp521
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pCMV Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27107743
Comments: deletion of final six Zn fingers

Proper citation: RRID:Addgene_104190 Copy   


  • RRID:Addgene_104189

http://www.addgene.org/104189

Species: Mus musculus
Genetic Insert: Zfp521
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pCMV Sport6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27107743

Proper citation: RRID:Addgene_104189 Copy   


  • RRID:Addgene_104561

    This resource has 1+ mentions.

http://www.addgene.org/104561

Species: Mus musculus
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24908396

Proper citation: RRID:Addgene_104561 Copy   


  • RRID:Addgene_104579

http://www.addgene.org/104579

Species: Mus musculus
Genetic Insert: Mouse CL kappa
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504

Proper citation: RRID:Addgene_104579 Copy   


  • RRID:Addgene_104581

http://www.addgene.org/104581

Species: Mus musculus
Genetic Insert: Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504

Proper citation: RRID:Addgene_104581 Copy   


  • RRID:Addgene_104589

    This resource has 1+ mentions.

http://www.addgene.org/104589

Species: Mus musculus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297

Proper citation: RRID:Addgene_104589 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X