Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.2/V5 mmu-mir-1947 Resource Report Resource Website |
RRID:Addgene_26342 | mmu-mir-1947 | Mus musculus | Ampicillin | PMID:20413612 | pre-miRNA hairpins and the surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST. | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 0 | |
|
pcDNA3.2/V5 mmu-mir-1968 Resource Report Resource Website |
RRID:Addgene_26344 | mmu-mir-1968 | Mus musculus | Ampicillin | PMID:20413612 | pre-miRNA hairpins and the surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST. | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 0 | |
|
pcDNA3.2/V5 mmu-mir-1964 Resource Report Resource Website |
RRID:Addgene_26343 | mmu-mir-1964 | Mus musculus | Ampicillin | PMID:20413612 | pre-miRNA hairpins and the surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST. | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 0 | |
|
pcDNA3.2/V5 mmu-mir-1933 Resource Report Resource Website |
RRID:Addgene_26340 | mmu-mir-1933 | Mus musculus | Ampicillin | PMID:20413612 | pre-miRNA hairpins and the surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST. | Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 0 | |
|
pBABE-hLin28B Resource Report Resource Website 1+ mentions |
RRID:Addgene_26358 | lin-28 homolog B | Homo sapiens | Ampicillin | PMID:19483683 | Backbone Size:5169; Vector Backbone:pBabe.puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | Addgene | 2026-10-31 02:08:11 | 4 | |
|
pLKO.1 Sox2 HM a Resource Report Resource Website 1+ mentions |
RRID:Addgene_26353 | Sox2 shRNA | Homo sapiens | Ampicillin | PMID:19801978 | SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA | Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 8 | |
|
pLKO.1 Sox2 3H b Resource Report Resource Website 1+ mentions |
RRID:Addgene_26352 | Sox2 shRNA | Homo sapiens | Ampicillin | PMID:19801978 | SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT | Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 3 | |
|
pWZL Sox2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26351 | Sox2 | Homo sapiens | Ampicillin | PMID:19801978 | Backbone Size:0; Vector Backbone:pWZL Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 1 | ||
|
pBABE FoxE1 Resource Report Resource Website |
RRID:Addgene_26350 | FOXE1 | Homo sapiens | Ampicillin | PMID:19801978 | Backbone Marker:Addgene Plasmid 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:11 | 0 | ||
|
p198 Dync1i2.F (Ex1a) Resource Report Resource Website |
RRID:Addgene_26448 | cytoplasmic dynein 1 intermediate chain 2 isoform F (exon 1a) | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
p177 Dync1i2.C (Ex 1b) Resource Report Resource Website |
RRID:Addgene_26445 | cytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1b) | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
p197 Dync1i2.B (Ex1a) Resource Report Resource Website |
RRID:Addgene_26447 | cytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1a) | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
p169 Dync1i1.C Resource Report Resource Website |
RRID:Addgene_26440 | cytoplasmic dynein 1 intermediate chain 1 isoform C | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
p173 Dync1i2.A (Ex1b) Resource Report Resource Website |
RRID:Addgene_26443 | cytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1b) | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
p172 Dync1i2.E (Ex 1b) Resource Report Resource Website |
RRID:Addgene_26442 | cytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b) | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 0 | |
|
MW001 (bacterial strain) Resource Report Resource Website |
RRID:Addgene_26452 | Ampicillin and Streptomycin | PMID:20621982 | F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZ M15 ΔlacX74 deoR recA1 endA1 araD139 Δ(ara, leu) 7649 galU galK rspL nupG [ λcI857 (cro-bioA) < > bla] | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Ampicillin and Streptomycin | Addgene | 2026-10-31 02:08:12 | 0 | |||
|
p203 Dync1li1 N235Y Resource Report Resource Website |
RRID:Addgene_26451 | cytoplasmic dynein light intermediate chain 1 N235Y | Mus musculus | Kanamycin | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pSC-A-amp/kan; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | changed Asparagine 235 to Tyrosine | Addgene | 2026-10-31 02:08:12 | 0 | ||
|
pECE Resource Report Resource Website 10+ mentions |
RRID:Addgene_26453 | Empty vector | Ampicillin | PMID:3518947 | Plasmid kindly provided to Addgene by Dr. Anne Brunet. There are a few single nucleotide differences and one small insertion relative to author sequence but they do not alter the MCS or affect plasmid function. | Backbone Marker:Bill Rutter; Backbone Size:2924; Vector Backbone:pECE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:12 | 10 | ||
|
2. p167 Dync1i1.D Resource Report Resource Website 1+ mentions |
RRID:Addgene_26439 | cytoplasmic dynein 1 intermediate chain 1 isoform D | Mus musculus | Kanamycin | PMID:20657784 | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin | N/A | Addgene | 2026-10-31 02:08:12 | 1 | |
|
pT/BH Resource Report Resource Website 1+ mentions |
RRID:Addgene_26554 | pT/BH | Ampicillin | There are three mismatches between Addgene and author sequence but they are in vector backbone. | Backbone Marker:Stratagene; Backbone Size:2914; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:08:13 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
