Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
KLHL7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39023 | KLHL7 | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/3II7/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:24 | 1 | ||
|
EP300 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39018 | EP300 | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/3I3J/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | codon-optimized | 2026-08-15 01:14:24 | 1 | |
|
NMRAL1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39016 | NMRAL1 | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/2WMD/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:24 | 1 | ||
|
YWHAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_39129 | YWHAG | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2B05/ | Backbone Marker:SGC; Vector Backbone:pTvHR21-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 | ||
|
TAF1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39117 | TAF1 | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/3UV4/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:25 | 1 | ||
|
AURKB Resource Report Resource Website 1+ mentions |
RRID:Addgene_39119 | AURKB | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/4AF3/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:25 | 1 | ||
|
TAF1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39118 | TAF1 | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/3UV5/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:25 | 2 | ||
|
BPTF Resource Report Resource Website 1+ mentions |
RRID:Addgene_39111 | BPTF | Homo sapiens | Kanamycin | http://www.thesgc.org/structures/3UV2/ | Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:25 | 4 | ||
|
pFB-Sec-NH Resource Report Resource Website 1+ mentions |
RRID:Addgene_39189 | none | Ampicillin | Backbone Marker:SGC; Vector Backbone:pFB-Sec-NH; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 1 | ||||
|
pCMV5-myc-Erk2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39222 | Erk2 | Rattus norvegicus | Ampicillin | PMID:11352917 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 1 | ||
|
pCMV-myc-ERK2-MEK1_fusion Resource Report Resource Website 1+ mentions |
RRID:Addgene_39194 | ERK2-MEK1 Fusion | Homo sapiens | Ampicillin | PMID:9799732 | rat ERK2 fused to human MEK1 with a linker in between | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 7 | |
|
pFB-CT10HF-LIC Resource Report Resource Website 1+ mentions |
RRID:Addgene_39191 | none | Ampicillin | Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: GATTGGAAGTAGAGGTTCTCTGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. | Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 8 | |||
|
PTPN5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39166 | PTPN5 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2BIJ/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:26 | 3 | ||
|
SPR Resource Report Resource Website 1+ mentions |
RRID:Addgene_39161 | sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/1Z6Z/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | codon-optimized | 2026-08-15 01:14:25 | 1 | |
|
RGS14 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39139 | RGS14 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2JNU/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 | ||
|
RGS10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39138 | RGS10 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2I59/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 | ||
|
PAK4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39137 | PAK4 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2Q0N/ | Backbone Marker:SGC; Vector Backbone:pGEX-6P-2-Nde-Xho; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 | ||
|
FDPS Resource Report Resource Website 1+ mentions |
RRID:Addgene_39131 | FDPS | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2QIS/ | Backbone Marker:SGC; Vector Backbone:p11; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 | ||
|
AKR7A2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39130 | AKR7A2 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2BP1/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 3 | ||
|
RGS16 Resource Report Resource Website 1+ mentions |
RRID:Addgene_39140 | RGS16 | Homo sapiens | Ampicillin | http://www.thesgc.org/structures/2BT2/ | Backbone Marker:SGC; Vector Backbone:pLIC-SGC1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:25 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.