Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGL2B -688/+64 Resource Report Resource Website |
RRID:Addgene_24944 | IL-10 promoter | Mus musculus | Ampicillin | PMID:10657644 | Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2B; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:35 | 0 | ||
|
MSCVhygro-F-Ezh2-F667I Resource Report Resource Website 1+ mentions |
RRID:Addgene_24927 | Ezh2 | Mus musculus | Ampicillin | PMID:20368440 | Backbone Size:7000; Vector Backbone:MSCV hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Phenylanaline(F)667 mutated to Isoleucine(I) | 2026-08-15 01:12:35 | 2 | |
|
FGF10-luciferase Resource Report Resource Website 1+ mentions |
RRID:Addgene_24994 | Fgf10 promoter | Mus musculus | Ampicillin | PMID:12490567 | Backbone Marker:ATTC; Backbone Size:6100; Vector Backbone:pXP1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:37 | 1 | ||
|
pCS2 xenopus twisted gastrulation Resource Report Resource Website |
RRID:Addgene_24974 | twisted gastrulation | Mus musculus | Ampicillin | PMID:11714670 | mRNA injection sense: cut with NotI, transcribe with SP6 Contains the Xenopus Chordin signal peptide and the N terminus until Ala41, followed by a Flag tag sequence. | Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:37 | 0 | |
|
pAL119-hCTLA4-Ig Resource Report Resource Website |
RRID:Addgene_25100 | ytotoxic T-murine Lymphocyte Antigen 4 | Mus musculus | Ampicillin | PMID:12515725 | Backbone Size:7337; Vector Backbone:pAL119; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:37 | 0 | ||
|
USP04 Resource Report Resource Website |
RRID:Addgene_25223 | usp04.001.229 | Mus musculus | Kanamycin | PDB: 3JYU. http://www.thesgc.org/structures/3JYU/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:38 | 0 | ||
|
pCDNA3-HA-mMcl-1(T144A) Resource Report Resource Website |
RRID:Addgene_25384 | mMCL1(T144A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed threonine 144 to alanine | 2026-08-15 01:12:43 | 0 | |
|
pBabe-HA-mMcl-1(T144A) Resource Report Resource Website |
RRID:Addgene_25386 | mMCL1(T144A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed threonine 144 to alanine | 2026-08-15 01:12:41 | 0 | |
|
pGEX4T-1-mMcl-1(S140A) Resource Report Resource Website |
RRID:Addgene_25381 | mMCL1(S140A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | changed serine 140 to alanine | 2026-08-15 01:12:43 | 0 | |
|
pLH116 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22651 | Proteolipid Protein | Mus musculus | Ampicillin | PMID:3469678 | Contains entire coding region of the mouse PLP cDNA including part of the 5' UTR. Used to make riboprobes by transcribing with SP6 polymerase to give a 980 bp antisense riboprobe or transcribing with T7 polymerase to give a 980bp sense riboprobe for RNA analysis on Northern blots. This PLP DNA cloned by Hudson lab. | Backbone Marker:Promega; Backbone Size:2867; Vector Backbone:pGEM3; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:14 | 2 | |
|
pEF1a-mRor2deltaIg Resource Report Resource Website |
RRID:Addgene_22629 | Ror2 delta Ig | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Ig domain | 2026-08-15 01:12:14 | 0 | |
|
pEF1a-mRor2Y641F Resource Report Resource Website |
RRID:Addgene_22635 | Ror2 Y641F | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Tyrosine 641 to Phenylalanine | 2026-08-15 01:12:14 | 0 | |
|
pEF1a-mRor2deltaPro Resource Report Resource Website |
RRID:Addgene_22634 | Ror2 delta Pro | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Pro domain | 2026-08-15 01:12:13 | 0 | |
|
pEF1a-mRor2deltaKringle Resource Report Resource Website |
RRID:Addgene_22630 | Ror2 delta Kringle | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Kringle domain | 2026-08-15 01:12:13 | 0 | |
|
pMyt1GFPicre-Knock-In Resource Report Resource Website |
RRID:Addgene_22657 | Myelin Transcription Factor 1 | Mus musculus | Ampicillin | 4899bp of genomic Myt1 sequences with MET of Exon 1 as 5' region of homolgy (NotI/PmeI). Inserted upstream of eGFP/icre/frt/loxP. 1403bp of genomic Myt1 sequence starts at exon 2 and extends past Exon 3 as 3' region of homology (ClaI/NheI) Inserted downstream of eGFP/icre/frt/loxP. The iCre-PolyA cassette was PCR'd out of the pBlue.iCre (a gift of Dr. Rolf Sprengel) with HindIII/KpnI ends. The iCre cassette was ligated to peGFP-C2 (HindIII/KpnI) (Clontech). The eGFP-iCre-PolyA cassette was PCR'd out with SalI ends. This eGFP-icre-PolyA (SalI) cassette was then cloned into pOSfrtloxP (Dr. Randy Thresher) upstream of the frt and loxP sites. 4886bp of 5' Mu genomic Myt1 DNA was inserted upstream of eGFP and the 1404 bp 3' Mu Genomic DNA was inserted downstream NEO gene. The entire pMyt1GFPicre-Knock-In has been sequenced and verified. | Backbone Marker:gift from Dr. Randy Thresher; Backbone Size:8272; Vector Backbone:pOSfrtloxP; Vector Types:Targeting vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:14 | 0 | ||
|
pmSin3BSF274 (short form) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22653 | mSin3B | Mus musculus | Ampicillin | PMID:15935060 | Used to see if truncated form of mSin3b would be biologically active when binding Mouse Myt1 This short form of mSIN3B was PCR'd from the full-length clone (pcDNAAmSin3B-Flag) which was a gift of Dr. Ronald dePinho. | Backbone Marker:Promega; Backbone Size:5565; Vector Backbone:pACT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:14 | 1 | |
|
pMycMyt1-7zf/IRES-Red Resource Report Resource Website 1+ mentions |
RRID:Addgene_22652 | Myelin Transcription Factor 1 | Mus musculus | Kanamycin | PMID:14962745 | Mu Myt1 complete sequence includes 7 Zn Fingers and a Myc Tag. This was subcloned into pIRES/Red made by R. A. Armstrong. The DsRed does not express due to problem with IRES This Myt1-7zf DNA was cut from the full-length clone (pMycMyt1-7zf) which was a gift of Dr. Jacob Hecksher-Sorensen. | Backbone Marker:R. Armstrong; Backbone Size:5635; Vector Backbone:pIRESRed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:14 | 2 | |
|
pLKO-1 shRev-Erbalpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_22747 | shRev-Erbalpha | Mus musculus | Ampicillin | PMID:20018698 | targeting sequence: GCGCTTTGCATCGTTGTTCAA | Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:14 | 1 | |
|
pAdTrack shALAS-1 Resource Report Resource Website |
RRID:Addgene_22748 | shALAS-1 | Mus musculus | Kanamycin | PMID:20018698 | targeting sequence: CCAAGATAGTAGCATTTGAAA | Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 0 | |
|
pCR-Myt1NB580 Resource Report Resource Website |
RRID:Addgene_22740 | Myelin Transcription Factor 1 | Mus musculus | Kanamycin | 580bp Myt1 insert can be released with EcoRI. This is the 580bp cDNA probe for Northern blots. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development" | Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
