Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: RAJ11 system (no transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39245 Copy
Vector Backbone Description: Backbone Marker:Registry of standard biological parts; Backbone Size:4042; Vector Backbone:pSB1AK3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Comments: This plasmid is used for inserting a 5'UTR in front of the GFP CDS using the NheI and EcoRi sites
Proper citation: RRID:Addgene_39240 Copy
Species: Homo sapiens
Genetic Insert: scFv-Fc-fusion specific for Notch2 (clone B9)
Vector Backbone Description: Backbone Marker:McCafferty lab unpublished; Vector Backbone:pBIOCAM5-3F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22842086
Comments: Binds to both mouse mNRR2 and human hNRR2. but neither NRR1.
Proper citation: RRID:Addgene_39348 Copy
Species: Homo sapiens
Genetic Insert: ERK1
Vector Backbone Description: Vector Backbone:NpT7-5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8444886
Proper citation: RRID:Addgene_39229 Copy
Species: Homo sapiens
Genetic Insert: scFv-Fc-fusion specific for Notch1 (clone B9)
Vector Backbone Description: Backbone Marker:McCafferty lab unpublished; Vector Backbone:pBIOCAM5-3F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22842086
Comments: Binds to both mouse mNRR1 and human hNRR1 but not NRR2.
Proper citation: RRID:Addgene_39344 Copy
Species: Homo sapiens
Genetic Insert: scFv specific for Jagged (clone D5)
Vector Backbone Description: Vector Backbone:pBIOCAM5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18047641
Proper citation: RRID:Addgene_39345 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Proper citation: RRID:Addgene_39296 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Comments: 1nt mismatch at bp#102 which may affect NheI site. Should not effect plasmid function.
Proper citation: RRID:Addgene_39295 Copy
Species: Homo sapiens
Genetic Insert: Myocilin wild-type
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19959812
Proper citation: RRID:Addgene_39326 Copy
Species: synthetic gene
Genetic Insert: MSP1E3D1_D73C
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET 28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19903557
Proper citation: RRID:Addgene_39328 Copy
Genetic Insert: KanR
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9717240
Proper citation: RRID:Addgene_39292 Copy
Species: Neisseria meningitidis
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:pET-based custom vector; Backbone Size:6400; Vector Backbone:pEC-K-MBP; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22745249
Proper citation: RRID:Addgene_39317 Copy
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5438; Vector Backbone:pET26b(+); Vector Types:Bacterial Expression, Bacterial expression, bacterial expression of recombinant antibody fragments in the form of single chain Fvs (scFvs); Bacterial Resistance:Kanamycin
Defining Citation: PMID:17156422
Proper citation: RRID:Addgene_39264 Copy
Genetic Insert: burs-mCD8-EGFP-T2A-Gal4
Vector Backbone Description: Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39463 Copy
Genetic Insert: mCD8-D2A-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39457 Copy
Species: Homo sapiens
Genetic Insert: HA-hTet1CDmu
Vector Backbone Description: Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21496894
Proper citation: RRID:Addgene_39455 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-45-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAAGTCCGCCATGCCCGA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb
Proper citation: RRID:Addgene_39446 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-36-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCACCGGGGTGGTGCCCA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb
Proper citation: RRID:Addgene_39428 Copy
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH75055; Vector Types:Plant Expression, MoClo Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34177999
Proper citation: RRID:Addgene_169093 Copy
Vector Backbone Description: Backbone Size:3488; Vector Types:Worm Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pLT61.1, Ligation number pLT61.
Proper citation: RRID:Addgene_1690 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.