Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: PPARalpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4000; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The PPARa cDNA was isolated from an adipocyte lambda ZAPII cDNA library (Tontonoz et al 1994 Genes Dev 8:1224-1234).
Proper citation: RRID:Addgene_22751 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Shinmura, K. et al. Direct evidence for the role of centrosomally localized p53 in the regulation of centrosome duplication. Oncogene. 2007 May 3;26(20):2939-44. Epub 2006 Oct 30.
Proper citation: RRID:Addgene_22727 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Comments: additional article reference: Bowman, T. et al. Tissue-specific inactivation of p53 tumor suppression in the mouse. Genes Dev. 1996 Apr 1;10(7):826-35.
Proper citation: RRID:Addgene_22729 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19668191
Proper citation: RRID:Addgene_22725 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to Plasmid 22664: pId1-B.IRES-Venus.
Proper citation: RRID:Addgene_22668 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to pId1-IRES-Venus (Plasmid #22663).
Proper citation: RRID:Addgene_22667 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3948; Vector Backbone:pCRII; Vector Types:cloning vector TT/AA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9373037
Comments: The murine Myt1 cDNA (6 zinc fingers) had 3 base mutations within the coding region (bp 806, 837 and 4344). These sites were corrected using Stratagene QuickChang Site-Directed mutagenesis. The Myt1 was sequenced after the mutagenesis and found to be correct. There is still one mutation in the 5' UTR at bp 529 (START codon is bp 532)
Proper citation: RRID:Addgene_22713 Copy
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Size:3410; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9600096
Proper citation: RRID:Addgene_22897 Copy
Species: Mus musculus
Genetic Insert: DHFR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/HisA & pBThybrid; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:19165721
Proper citation: RRID:Addgene_23011 Copy
Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343417
Comments: This clone was assembled from multiple PCR products by using the following
primers, described by their sequence relationship to the transcribed DUP RNA.
DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33
exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo-
gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT
GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2
and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is
homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT
GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6
(TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron
1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA
GAA) also contains the ApaI site and is complementary to intron 1 and primer
DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon
1. A series of PCRs was performed with the following primers and templates.
Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4,
5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the
1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8
PCR products as templates. A final PCR assembled a complete fragment by
using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final
PCR product was cleaved with NsiI and DraIII and inserted into the CMV
DUP33 vector also cleaved with NsiI and DraIII. This clone was designated
DUP4-1.
Proper citation: RRID:Addgene_23022 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11266458
Proper citation: RRID:Addgene_22958 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11266458
Proper citation: RRID:Addgene_22956 Copy
Species: Mus musculus
Genetic Insert: Mfn1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.1(-)/Myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12527753
Proper citation: RRID:Addgene_23212 Copy
Species: Mus musculus
Genetic Insert: Bim EL (3SA)
Vector Backbone Description: Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23100 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23101 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23102 Copy
Species: Mus musculus
Genetic Insert: mouse gammaF crystallin promoter:mCherry
Vector Backbone Description: Backbone Size:0; Vector Backbone:p817 (pBSII derivate); Vector Types:multicloning site flanked by I-SceI sites; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20359307
Comments: A=>G and G=>A mismatches in gene do not have any functional significance.
Proper citation: RRID:Addgene_23154 Copy
Species: Mus musculus
Genetic Insert: mouse Gcn5 mRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4473; Vector Backbone:pCMV-sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10675335
Proper citation: RRID:Addgene_23098 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23092 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23093 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
