Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 118 showing 2341 ~ 2360 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_42157

http://www.addgene.org/42157

Genetic Insert: GFP-RT-GFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.

Proper citation: RRID:Addgene_42157 Copy   


http://www.addgene.org/42037

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874

Proper citation: RRID:Addgene_42037 Copy   


  • RRID:Addgene_42158

http://www.addgene.org/42158

Genetic Insert: YFP-RT-YFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.

Proper citation: RRID:Addgene_42158 Copy   


http://www.addgene.org/42038

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874

Proper citation: RRID:Addgene_42038 Copy   


  • RRID:Addgene_42150

    This resource has 1+ mentions.

http://www.addgene.org/42150

Species: Synthetic
Genetic Insert: RT-cassette
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.

Proper citation: RRID:Addgene_42150 Copy   


http://www.addgene.org/42030

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874

Proper citation: RRID:Addgene_42030 Copy   


  • RRID:Addgene_42142

    This resource has 1+ mentions.

http://www.addgene.org/42142

Species: Homo sapiens
Genetic Insert: c-Myc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21668996

Proper citation: RRID:Addgene_42142 Copy   


http://www.addgene.org/42143

Species: Synthetic
Genetic Insert: pCMV-N1-superfolderGFP
Vector Backbone Description: Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22355283

Proper citation: RRID:Addgene_42143 Copy   


  • RRID:Addgene_42145

http://www.addgene.org/42145

Species: Caenorhabditis elegans
Genetic Insert: N-TAP TAG::[(G4S)3]::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]

Proper citation: RRID:Addgene_42145 Copy   


  • RRID:Addgene_42146

http://www.addgene.org/42146

Species: Caenorhabditis elegans
Genetic Insert: N-TAP-tag::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]

Proper citation: RRID:Addgene_42146 Copy   


  • RRID:Addgene_42147

http://www.addgene.org/42147

Species: Caenorhabditis elegans
Genetic Insert: mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]

Proper citation: RRID:Addgene_42147 Copy   


  • RRID:Addgene_42259

    This resource has 1+ mentions.

http://www.addgene.org/42259

Species: Mus musculus
Genetic Insert: Frizzled 7
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888

Proper citation: RRID:Addgene_42259 Copy   


  • RRID:Addgene_42252

    This resource has 1+ mentions.

http://www.addgene.org/42252

Genetic Insert: Streptococcus pyogenes Cas9-3X Flag
Vector Backbone Description: Vector Backbone:unknown; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23360964
Comments: Plasmid Features: CAG enhancer-CMV promoter = 7466-370 Cas9 = 409-4512 NLS = 4519-4539 3X FLAG = 4546-4611 BGHpA = 4612-4839

Proper citation: RRID:Addgene_42252 Copy   


  • RRID:Addgene_42254

    This resource has 1+ mentions.

http://www.addgene.org/42254

Species: Mus musculus
Genetic Insert: Frizzled 2
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Comments: Fzd2 insert contains S193A compared with NM_020510.2. Mutation has no effect on plasmid function

Proper citation: RRID:Addgene_42254 Copy   


  • RRID:Addgene_42256

    This resource has 1+ mentions.

http://www.addgene.org/42256

Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888

Proper citation: RRID:Addgene_42256 Copy   


  • RRID:Addgene_42258

    This resource has 1+ mentions.

http://www.addgene.org/42258

Species: Mus musculus
Genetic Insert: Frizzled 6
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888

Proper citation: RRID:Addgene_42258 Copy   


  • RRID:Addgene_42250

    This resource has 100+ mentions.

http://www.addgene.org/42250

Vector Backbone Description: Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964

Proper citation: RRID:Addgene_42250 Copy   


  • RRID:Addgene_42248

http://www.addgene.org/42248

Species: Danio rerio
Genetic Insert: gRNA-tia1l
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42248 Copy   


  • RRID:Addgene_42240

    This resource has 1+ mentions.

http://www.addgene.org/42240

Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103964

Proper citation: RRID:Addgene_42240 Copy   


  • RRID:Addgene_42242

http://www.addgene.org/42242

Species: Danio rerio
Genetic Insert: gRNA-drd3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42242 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X