Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Zebrafish-gRNA-0003
 
Resource Report
Resource Website
RRID:Addgene_42243 gRNA-fh site #1 Danio rerio Kanamycin PMID:23360964 Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0006
 
Resource Report
Resource Website
RRID:Addgene_42246 gRNA-rgs4 Danio rerio Kanamycin PMID:23360964 Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
pENTR-3xFLAG-YAP1-S127A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42239 YAP1 Homo sapiens Kanamycin PMID:22308401 Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Serine 127 changed to alanine 2026-08-15 01:14:51 1
pcDNA3 βarr1 S412D Flag
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42196 β-arrestin 1 S412D Rattus norvegicus Ampicillin PMID:9924018 Flag epitope-tagged truncation mutants of β-arrestin 1 were prepared by the polymerase chain reaction (PCR), incorporating an Eco RI site, minimal Kozak sequence (ACC), and initiator methionine codon into the 5' primer, and the Flag epitope sequence, stop codon, and an Xho I site into the 3' primer. PCR products were subcloned into pcDNA3. DNA sequences were confirmed by dideoxynucleotide sequencing. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S412D 2026-08-15 01:14:51 2
Fz4-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42197 Frizzled 4 Mus musculus Kanamycin PMID:12958364 Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 3
pX330-U6-Chimeric_BB-CBh-hSpCas9
 
Resource Report
Resource Website
1000+ mentions
RRID:Addgene_42230 humanized S. pyogenes Cas9 Ampicillin PMID:23287718 Alternate plasmid name: pSpCas9(BB) (PX330) For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/ Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 1949
pTorPE-GR-GECO1.1
 
Resource Report
Resource Website
RRID:Addgene_42198 GR-GECO1.1 Synthetic Ampicillin PMID:23256581 Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pTorPE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
pMJ920
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_42234 Cas9 Synthetic Ampicillin PMID:23386978 Backbone Marker:QB3 MacroLab; Backbone Size:6145; Vector Backbone:MacroLab 6D; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin codon-optimized synthetic DNA sequence 2026-08-15 01:14:51 41
pCS6-mPSD95a-TSa-HA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42235 PSD95 Ampicillin PMID:20155731 Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 2
Tol2-zTRAP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42236 EGFP-Rpl10a Danio rerio Ampicillin PMID:23281262 Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 1
pMyC
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42192 Hygromycin PMID:33006405 Vector constructed by Dr. Arie Geerlof at EMBL-Hamburg (now at Helmholtz Zentrum München) Backbone Marker:Daugelat et al 2003; Backbone Size:6900; Vector Backbone:pSD26; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin 2026-08-15 01:14:51 6
PSD95-TS:YSOG2
 
Resource Report
Resource Website
RRID:Addgene_42227 PSD95 Ampicillin PMID:23103964 The S->T point mutation found in the Addgene QC sequence does not affect the plasmid function. Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_42229 humanized S. pyogenes Cas9 Ampicillin PMID:23287718 Note, Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/ Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 38
EGFP G protein Gamma 3(F70A,F71A) in pcDNA3.1
 
Resource Report
Resource Website
RRID:Addgene_42185 G protein Gamma 3(F70A, F71A) Mus musculus Ampicillin PMID:23213235 Mutations created by using the Quik Change Mutagenesis kit. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin F70A, F71A 2026-08-15 01:14:51 0
pCMV-GR-GECO1.1
 
Resource Report
Resource Website
RRID:Addgene_42186 GR-GECO1.1 Synthetic Ampicillin PMID:23256581 Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
pCMV-GR-GECO1.2
 
Resource Report
Resource Website
RRID:Addgene_42187 GR-GECO1.2 Synthetic Ampicillin PMID:23256581 Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
EGFP G protein Gamma 3(K68A,K69A,F70A,F71A) in pcDNA3.1
 
Resource Report
Resource Website
RRID:Addgene_42189 Gamma 3(K68A,K69A,F70A,F71A) Mus musculus Ampicillin PMID:23213235 Mutations created by using the Quik Change mutagenesis kit Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K68A,K69A,F70A,F71A 2026-08-15 01:14:51 0
pMQ430
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42216 dam E. coli K-12 Ampicillin PMID:12897023 Vector Backbone:pBAD18; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 1
pcDNA3-GFP-IMP2-2_antisense-control
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42174 Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control Homo sapiens Ampicillin PMID:23257922 Backbone Marker:invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 2
pC1-PIP-SHOW
 
Resource Report
Resource Website
RRID:Addgene_42212 PIP-SHOW Synthetic Kanamycin PMID:22369174 Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.