Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCMV mouse sidekick2
 
Resource Report
Resource Website 		RRID:Addgene_18735 Sidekick-2 Mus musculus Kanamycin PMID:18216854 The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC. Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:38 0
pCMV mouse Dscam
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_18737 Dscam Mus musculus Kanamycin PMID:18216854 An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT. Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:38 1
TRPML2-YFP
 
Resource Report
Resource Website 		RRID:Addgene_18830 TRPML2 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:39 0
TRPML2-CFP
 
Resource Report
Resource Website 		RRID:Addgene_18831 TRPML2 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:39 0
TRPML3-HA
 
Resource Report
Resource Website 		RRID:Addgene_18832 TRPML3 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:39 0
TRPML3-CFP
 
Resource Report
Resource Website 		RRID:Addgene_18834 TRPML3 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q165R, F210Y 2026-08-15 01:11:39 0
pWZL Blast mouse E-cadherin
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_18804 E-cadherin Mus musculus Ampicillin PMID:18483246 Full-length murine E-cadherin cDNA cloned into pWZL blast. Backbone Size:5100; Vector Backbone:pWZL-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:39 13
N-Cadherin-EGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_18870 N-Cadherin Mus musculus Kanamycin PMID:17765678 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:40 23
pdelta105-ABCb10-GFP
 
Resource Report
Resource Website 		RRID:Addgene_19034 ABCb10 lacking the mitochondrial targetting sequence Mus musculus Kanamycin PMID:15215243 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:11:41 0
pHIV-Wnt1HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_18983 wingless-related MMTV integration site 1 Mus musculus Ampicillin PMID:18371425 The Wnt1HA insert was cloned into the XbaI site of HIV-Zsgreen in order to generate a bicistronic lentivirus that coexpresses Wnt1HA with Zsgreen under the control of the EF1alpha promoter. Gerrit Dijkgraaf in Zena Werb's lab cloned this virus. Backbone Size:7664; Vector Backbone:HIV-Zsgreen; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:11:41 2
pKS-DTA miR-106b~25
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19030 microRNA 106a-25 Mus musculus Ampicillin PMID:18329372 Backbone Size:0; Vector Backbone:pKS-DTA; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:11:41 1
pABCb10-GFP
 
Resource Report
Resource Website 		RRID:Addgene_19031 ATP-binding cassette, sub-family B (MDR/TAP), member 10 Mus musculus Ampicillin PMID:15215243 Backbone Marker:Clontech; Backbone Size:6092; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:41 0
pEF-TAZ-N-Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19025 TAZ Mus musculus Ampicillin PMID:11118213 The murine TAZ cDNA was subcloned into pEF-BOS lacking the SV40 origin (Mizushima and Nagata, 1990) to generate pEF-TAZ. A Flag tag was inserted into the N-terminus of mTAZ cDNA by PCR, and cloned into pEF-BOS to create pEF-TAZ-N-Flag. Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Vector has no SV40 origin 2026-08-15 01:11:41 5
pKO-II-miR-17~92
 
Resource Report
Resource Website 		RRID:Addgene_19029 microRNA 17-92 Mus musculus Ampicillin PMID:18329372 Backbone Size:0; Vector Backbone:pKOII; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:11:41 0
pBS-miR106a-363
 
Resource Report
Resource Website 		RRID:Addgene_19028 microRNA 106a-363 Mus musculus Ampicillin PMID:18329372 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:11:41 0
mADAM17 in pcDNA3.1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19141 ADAM17 Mus musculus Ampicillin PMID:17389606 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:42 4
mADAM10 deltaMP in pQCXIP cFLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19138 ADAM10 Mus musculus Ampicillin PMID:17389606 Backbone Marker:Clontech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin delta 56-457 2026-08-15 01:11:42 1
pIND WS full (heatshock promotor)
 
Resource Report
Resource Website 		RRID:Addgene_19275 mouse Wrn cDNA Mus musculus Ampicillin Backbone Size:5000; Vector Backbone:pIND; Vector Types:n/a; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 0
pGL2-NOS2Promoter-Luciferase
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_19296 NOS2 Promoter Mus musculus Ampicillin PMID:7692452 Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 11
pBS-iNOS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19295 inducible nitric oxide synthase Mus musculus Ampicillin PMID:1379716 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:43 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch