Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Zebrafish-gRNA-0003 Resource Report Resource Website |
RRID:Addgene_42243 | gRNA-fh site #1 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
Zebrafish-gRNA-0006 Resource Report Resource Website |
RRID:Addgene_42246 | gRNA-rgs4 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
pENTR-3xFLAG-YAP1-S127A Resource Report Resource Website 1+ mentions |
RRID:Addgene_42239 | YAP1 | Homo sapiens | Kanamycin | PMID:22308401 | Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Serine 127 changed to alanine | 2026-08-15 01:14:51 | 1 | |
|
pcDNA3 βarr1 S412D Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_42196 | β-arrestin 1 S412D | Rattus norvegicus | Ampicillin | PMID:9924018 | Flag epitope-tagged truncation mutants of β-arrestin 1 were prepared by the polymerase chain reaction (PCR), incorporating an Eco RI site, minimal Kozak sequence (ACC), and initiator methionine codon into the 5' primer, and the Flag epitope sequence, stop codon, and an Xho I site into the 3' primer. PCR products were subcloned into pcDNA3. DNA sequences were confirmed by dideoxynucleotide sequencing. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S412D | 2026-08-15 01:14:51 | 2 |
|
Fz4-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_42197 | Frizzled 4 | Mus musculus | Kanamycin | PMID:12958364 | Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 3 | |
|
pX330-U6-Chimeric_BB-CBh-hSpCas9 Resource Report Resource Website 1000+ mentions |
RRID:Addgene_42230 | humanized S. pyogenes Cas9 | Ampicillin | PMID:23287718 | Alternate plasmid name: pSpCas9(BB) (PX330) For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/ | Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 1949 | ||
|
pTorPE-GR-GECO1.1 Resource Report Resource Website |
RRID:Addgene_42198 | GR-GECO1.1 | Synthetic | Ampicillin | PMID:23256581 | Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pTorPE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
pMJ920 Resource Report Resource Website 10+ mentions |
RRID:Addgene_42234 | Cas9 | Synthetic | Ampicillin | PMID:23386978 | Backbone Marker:QB3 MacroLab; Backbone Size:6145; Vector Backbone:MacroLab 6D; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | codon-optimized synthetic DNA sequence | 2026-08-15 01:14:51 | 41 | |
|
pCS6-mPSD95a-TSa-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_42235 | PSD95 | Ampicillin | PMID:20155731 | Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 2 | |||
|
Tol2-zTRAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_42236 | EGFP-Rpl10a | Danio rerio | Ampicillin | PMID:23281262 | Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 1 | ||
|
pMyC Resource Report Resource Website 1+ mentions |
RRID:Addgene_42192 | Hygromycin | PMID:33006405 | Vector constructed by Dr. Arie Geerlof at EMBL-Hamburg (now at Helmholtz Zentrum München) | Backbone Marker:Daugelat et al 2003; Backbone Size:6900; Vector Backbone:pSD26; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:14:51 | 6 | |||
|
PSD95-TS:YSOG2 Resource Report Resource Website |
RRID:Addgene_42227 | PSD95 | Ampicillin | PMID:23103964 | The S->T point mutation found in the Addgene QC sequence does not affect the plasmid function. | Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro Resource Report Resource Website 10+ mentions |
RRID:Addgene_42229 | humanized S. pyogenes Cas9 | Ampicillin | PMID:23287718 | Note, Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/ | Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 38 | ||
|
EGFP G protein Gamma 3(F70A,F71A) in pcDNA3.1 Resource Report Resource Website |
RRID:Addgene_42185 | G protein Gamma 3(F70A, F71A) | Mus musculus | Ampicillin | PMID:23213235 | Mutations created by using the Quik Change Mutagenesis kit. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | F70A, F71A | 2026-08-15 01:14:51 | 0 |
|
pCMV-GR-GECO1.1 Resource Report Resource Website |
RRID:Addgene_42186 | GR-GECO1.1 | Synthetic | Ampicillin | PMID:23256581 | Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
pCMV-GR-GECO1.2 Resource Report Resource Website |
RRID:Addgene_42187 | GR-GECO1.2 | Synthetic | Ampicillin | PMID:23256581 | Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
EGFP G protein Gamma 3(K68A,K69A,F70A,F71A) in pcDNA3.1 Resource Report Resource Website |
RRID:Addgene_42189 | Gamma 3(K68A,K69A,F70A,F71A) | Mus musculus | Ampicillin | PMID:23213235 | Mutations created by using the Quik Change mutagenesis kit | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K68A,K69A,F70A,F71A | 2026-08-15 01:14:51 | 0 |
|
pMQ430 Resource Report Resource Website 1+ mentions |
RRID:Addgene_42216 | dam | E. coli K-12 | Ampicillin | PMID:12897023 | Vector Backbone:pBAD18; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 1 | ||
|
pcDNA3-GFP-IMP2-2_antisense-control Resource Report Resource Website 1+ mentions |
RRID:Addgene_42174 | Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control | Homo sapiens | Ampicillin | PMID:23257922 | Backbone Marker:invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 2 | ||
|
pC1-PIP-SHOW Resource Report Resource Website |
RRID:Addgene_42212 | PIP-SHOW | Synthetic | Kanamycin | PMID:22369174 | Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
