Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 119 showing 2361 ~ 2380 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_42243

http://www.addgene.org/42243

Species: Danio rerio
Genetic Insert: gRNA-fh site #1
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42243 Copy   


  • RRID:Addgene_42246

http://www.addgene.org/42246

Species: Danio rerio
Genetic Insert: gRNA-rgs4
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42246 Copy   


  • RRID:Addgene_42239

    This resource has 1+ mentions.

http://www.addgene.org/42239

Species: Homo sapiens
Genetic Insert: YAP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22308401

Proper citation: RRID:Addgene_42239 Copy   


  • RRID:Addgene_42196

    This resource has 1+ mentions.

http://www.addgene.org/42196

Species: Rattus norvegicus
Genetic Insert: β-arrestin 1 S412D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9924018
Comments: Flag epitope-tagged truncation mutants of β-arrestin 1 were prepared by the polymerase chain reaction (PCR), incorporating an Eco RI site, minimal Kozak sequence (ACC), and initiator methionine codon into the 5' primer, and the Flag epitope sequence, stop codon, and an Xho I site into the 3' primer. PCR products were subcloned into pcDNA3. DNA sequences were confirmed by dideoxynucleotide sequencing.

Proper citation: RRID:Addgene_42196 Copy   


  • RRID:Addgene_42197

    This resource has 1+ mentions.

http://www.addgene.org/42197

Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12958364
Comments: Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4

Proper citation: RRID:Addgene_42197 Copy   


http://www.addgene.org/42230

Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Alternate plasmid name: pSpCas9(BB) (PX330) For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/

Proper citation: RRID:Addgene_42230 Copy   


  • RRID:Addgene_42198

http://www.addgene.org/42198

Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pTorPE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581

Proper citation: RRID:Addgene_42198 Copy   


  • RRID:Addgene_42234

    This resource has 10+ mentions.

http://www.addgene.org/42234

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:QB3 MacroLab; Backbone Size:6145; Vector Backbone:MacroLab 6D; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23386978

Proper citation: RRID:Addgene_42234 Copy   


  • RRID:Addgene_42235

    This resource has 1+ mentions.

http://www.addgene.org/42235

Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20155731

Proper citation: RRID:Addgene_42235 Copy   


  • RRID:Addgene_42236

    This resource has 1+ mentions.

http://www.addgene.org/42236

Species: Danio rerio
Genetic Insert: EGFP-Rpl10a
Vector Backbone Description: Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281262

Proper citation: RRID:Addgene_42236 Copy   


  • RRID:Addgene_42192

    This resource has 1+ mentions.

http://www.addgene.org/42192

Vector Backbone Description: Backbone Marker:Daugelat et al 2003; Backbone Size:6900; Vector Backbone:pSD26; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33006405
Comments: Vector constructed by Dr. Arie Geerlof at EMBL-Hamburg (now at Helmholtz Zentrum München)

Proper citation: RRID:Addgene_42192 Copy   


  • RRID:Addgene_42227

http://www.addgene.org/42227

Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103964
Comments: The S->T point mutation found in the Addgene QC sequence does not affect the plasmid function.

Proper citation: RRID:Addgene_42227 Copy   


http://www.addgene.org/42229

Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Note, Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/

Proper citation: RRID:Addgene_42229 Copy   


http://www.addgene.org/42185

Species: Mus musculus
Genetic Insert: G protein Gamma 3(F70A, F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change Mutagenesis kit.

Proper citation: RRID:Addgene_42185 Copy   


  • RRID:Addgene_42186

http://www.addgene.org/42186

Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581

Proper citation: RRID:Addgene_42186 Copy   


  • RRID:Addgene_42187

http://www.addgene.org/42187

Species: Synthetic
Genetic Insert: GR-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581

Proper citation: RRID:Addgene_42187 Copy   


http://www.addgene.org/42189

Species: Mus musculus
Genetic Insert: Gamma 3(K68A,K69A,F70A,F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change mutagenesis kit

Proper citation: RRID:Addgene_42189 Copy   


  • RRID:Addgene_42216

    This resource has 1+ mentions.

http://www.addgene.org/42216

Species: E. coli K-12
Genetic Insert: dam
Vector Backbone Description: Vector Backbone:pBAD18; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12897023

Proper citation: RRID:Addgene_42216 Copy   


http://www.addgene.org/42174

Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 2-2 antisense control
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23257922

Proper citation: RRID:Addgene_42174 Copy   


  • RRID:Addgene_42212

http://www.addgene.org/42212

Species: Synthetic
Genetic Insert: PIP-SHOW
Vector Backbone Description: Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22369174

Proper citation: RRID:Addgene_42212 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X