Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Sir2
Vector Backbone Description: Vector Backbone:p413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19390637
Proper citation: RRID:Addgene_51742 Copy
Species: Homo sapiens
Genetic Insert: ESAM
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 20
Proper citation: RRID:Addgene_51751 Copy
Species: Homo sapiens
Genetic Insert: EPHB1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 19
Proper citation: RRID:Addgene_51750 Copy
Species: Homo sapiens
Genetic Insert: ICAM5
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 28
Proper citation: RRID:Addgene_51759 Copy
Species: Homo sapiens
Genetic Insert: ICAM2
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 27
Proper citation: RRID:Addgene_51758 Copy
Species: Homo sapiens
Genetic Insert: FCGR2a
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 22
Proper citation: RRID:Addgene_51754 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51762 Copy
Species: Mus musculus
Genetic Insert: Jnk interacting protein 1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9235893
Proper citation: RRID:Addgene_51767 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGAGCGCACCATCTTCTTCA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51763 Copy
Species: Homo sapiens
Genetic Insert: KIAA
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 31
Proper citation: RRID:Addgene_51808 Copy
Species: Homo sapiens
Genetic Insert: JAM3
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 30
Proper citation: RRID:Addgene_51807 Copy
Species: Homo sapiens
Genetic Insert: IL6ST
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 29
Proper citation: RRID:Addgene_51806 Copy
Species: Mus musculus
Genetic Insert: cry1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452855
Proper citation: RRID:Addgene_51892 Copy
Species: Homo sapiens
Genetic Insert: Rbx1
Vector Backbone Description: Vector Backbone:pfastbac; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452855
Proper citation: RRID:Addgene_51893 Copy
Species: Homo sapiens
Genetic Insert: PRNP
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 88
Proper citation: RRID:Addgene_51811 Copy
Species: Mus musculus
Genetic Insert: DN JNK2
Vector Backbone Description: Vector Backbone:alphaMHC vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14517246
Comments: Addgene sequencing found the following additional mutations: S2G, S6C and G8S, they not thought to effect the function of the insert.
Proper citation: RRID:Addgene_51931 Copy
Species: Rattus norvegicus
Genetic Insert: Chimeric Synaptophysin-mCherry-Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24529383
Proper citation: RRID:Addgene_51819 Copy
Genetic Insert: humanized S.pyogenes Cas9
Vector Backbone Description: Backbone Size:4071; Vector Backbone:pCS2; Vector Types:Mammalian Expression, CRISPR, medaka, zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24728957
Comments: This plasmid is modified from pX330-U6-Chimeric BB-CBh-hSpCas9 originated from Feng Zhang Lab.
Proper citation: RRID:Addgene_51815 Copy
Species: O. latipes
Genetic Insert: Tol2 Transposase
Vector Backbone Description: Vector Backbone:pBluscript II SK+; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24504478
Proper citation: RRID:Addgene_51818 Copy
Species: Homo sapiens
Genetic Insert: PTTG
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 39
Proper citation: RRID:Addgene_51822 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
