Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: KRAS
Vector Backbone Description: Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239284
Proper citation: RRID:Addgene_52729 Copy
Genetic Insert: KIlac strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: KIlac refers to the knock-in of the wild-type operon into the attTn7 locus; this strain was used as the reference strain for all analyses. We constructed all knock-in strains using the approach of McKenzie and Craig. The knock-in contained the entire lac operon starting 75bp upstream of lacI and ending 100bp downstream of lacA. The ΔZYA strain was transformed with pGRG37. The plasmid carried both the lac operon and the transposon genes tnsABCD, which allow for a site-specific insertion at attTn7.
Proper citation: RRID:Addgene_52696 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2736; Vector Backbone:pX330; Vector Types:CRISPR, Toxoplasma gondii; Bacterial Resistance:Ampicillin
Comments: Cong L, Ran FA, Cox D, Lin S, Barretto R, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819–823. doi:10.1126/science.1231143.
Proper citation: RRID:Addgene_52694 Copy
Species: Schizosaccharomyces pombe
Genetic Insert: none
Vector Backbone Description: Vector Backbone:pREP41; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52690 Copy
Species: Other
Genetic Insert: NGFP+Z-fusion
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5641; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15631464
Proper citation: RRID:Addgene_52734 Copy
Species: Other
Genetic Insert: link-NGFP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5641; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15631464
Proper citation: RRID:Addgene_52732 Copy
Species: Homo sapiens
Genetic Insert: Toll/IL-1 Receptor adaptor protein
Vector Backbone Description: Vector Backbone:MSCV2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24529375
Proper citation: RRID:Addgene_52739 Copy
Species: Synthetic
Genetic Insert: nls-ha-MCP-VenusN-nls-ha-PCP-VenusC
Vector Backbone Description: Backbone Size:6200; Vector Backbone:phage; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24402470
Proper citation: RRID:Addgene_52985 Copy
Vector Backbone Description: Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Comments: attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag
Proper citation: RRID:Addgene_52904 Copy
Species: west nile virus
Genetic Insert: prM-E
Vector Backbone Description: Vector Backbone:pPSClo; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52882 Copy
Genetic Insert: lck-GCaMP6f
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52924 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal4
Vector Backbone Description: Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25605786
Proper citation: RRID:Addgene_52889 Copy
Species: Homo sapiens
Genetic Insert: shRNA targeting mitogen-activated protein kinase p38
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24670723
Proper citation: RRID:Addgene_52920 Copy
Species: Mus musculus
Genetic Insert: mP2X4-pHluorin123
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24935743
Proper citation: RRID:Addgene_52926 Copy
Species: Aedes aegypti
Genetic Insert: polyubiquitin promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4747; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Proper citation: RRID:Addgene_52891 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21189298
Comments: This strain is a precursor to HL 3262 (identical strain, except KanR cassette on chromosome allows for selection).
Proper citation: RRID:Addgene_52936 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Proper citation: RRID:Addgene_52951 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:10130; Vector Backbone:pFUGW; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25075903
Comments: Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_52962 Copy
Species: Synthetic
Genetic Insert: S. pyogenes sgRNA cassette
Vector Backbone Description: Vector Backbone:Custom; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25075903
Comments: Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_52963 Copy
Species: Drosophila melanogaster
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21565616
Proper citation: RRID:Addgene_52972 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
